View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1449_high_18 (Length: 293)
Name: NF1449_high_18
Description: NF1449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1449_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 7e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 180 - 283
Target Start/End: Complemental strand, 10798835 - 10798732
Alignment:
| Q |
180 |
aatgcaagaatacaaaatggatagttttttccctccctattaaggctattcactagccttattccttgagttacaaagggagactcataggtttattgtt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10798835 |
aatgcaagaatacaaaatggatagttttttccctccctattaaggctattcactagccttattccttgagttacaaagggagactcataggtttattgtt |
10798736 |
T |
|
| Q |
280 |
tcat |
283 |
Q |
| |
|
|||| |
|
|
| T |
10798735 |
tcat |
10798732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 7 - 120
Target Start/End: Complemental strand, 10799008 - 10798895
Alignment:
| Q |
7 |
acccttttgatgaagcaattcattggtcctaagatcatgatataaagtttaaatattccatattacttttgnnnnnnntaaagttttcatcaatattggt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10799008 |
acccttttgatgaagcaattcattggtcctaagatcatgatgtaaagtttaaatattccatattacttttgaaaaaaataaagttttcatcaatattggt |
10798909 |
T |
|
| Q |
107 |
tgattgataaggac |
120 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
10798908 |
tgattgataaggac |
10798895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University