View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1449_high_20 (Length: 277)
Name: NF1449_high_20
Description: NF1449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1449_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 15 - 271
Target Start/End: Original strand, 9433371 - 9433627
Alignment:
| Q |
15 |
tgtggttgaagttgttgaaccggagccttgcatggggtttttacaaagagagaatttctcgacggagattattgagagtatttcgccggaggatcttcaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9433371 |
tgtggttgaagttgttgaaccggagccttgcatggggtttttacaaagagagaatttctcgacggagattattgagagtatttcgccggaggatcttcaa |
9433470 |
T |
 |
| Q |
115 |
ccgacggtgaagctttgtgtggatggtttacagtcttcttcagtggctgtgaaacggtctgctgcggcgaaattgaggttgcttgcaaagaatcgagctg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9433471 |
ccgacggtgaagctttgtgtggatggtttacagtcttcttcagtggctgtgaaacggtctgctgcggcgaaattgaggttgcttgcaaagaatcgagctg |
9433570 |
T |
 |
| Q |
215 |
ataatcgtgttttgatcggtgaatccggtgctgtacctttgcttgttcctttgcttc |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9433571 |
ataatcgtgttttgatcggtgaatccggtgctgtacctttgcttgttcctttgcttc |
9433627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University