View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1449_high_24 (Length: 262)
Name: NF1449_high_24
Description: NF1449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1449_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 25 - 247
Target Start/End: Complemental strand, 6633897 - 6633675
Alignment:
| Q |
25 |
gtgcatcatgcatggaactttcttcaaagttgtcatgtatcatatgaactttgattatgaatattaatttggttttgtatgtgtgcagaggatgtggttg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6633897 |
gtgcatcatgcatggaactttcttcaaagttgtcatgtatcatatgaactttgattatgaatattaatttggttttgtatgtgtgcagaggatgtggttg |
6633798 |
T |
 |
| Q |
125 |
cacaggaagagacttcggctaaggaagaagttgtcgaaaacacaaatgtttcagcctctgaagctgaagctgaagctggaggtgaaaataattaaggtga |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6633797 |
cacaggaagagacttcggctaaggaagaagttgtcgaaaacacaaatgtttcagcctctgaagctgaagctgaagctggaggtgaaaataattaaggtga |
6633698 |
T |
 |
| Q |
225 |
tttgaaaactggggagaggaagt |
247 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
6633697 |
tttgaaaactggggagaggaagt |
6633675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University