View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1449_high_30 (Length: 239)
Name: NF1449_high_30
Description: NF1449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1449_high_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 8 - 225
Target Start/End: Original strand, 28335802 - 28336017
Alignment:
| Q |
8 |
tagcataggttcggttaagttttctcaattgtgattctctttgattcaagtgtttgacgttgagagaggaactttgtgtcacatatgtgggtttcctaac |
107 |
Q |
| |
|
|||| ||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
28335802 |
tagcctaggttcagttaagtttcctcaattgtgattctctttgattcaagtgtttgacgttgagagaggaactttgtctcacatatgtgggtttgctaac |
28335901 |
T |
|
| Q |
108 |
ttccacactagagtgttagatacggttgtctgagnnnnnnnagctacaatgataaaaggataaaaatgcaaaaatagcccgtttgattgatcgagtgtgt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28335902 |
ttccacactagagtgttagatacggttgtttgag-ttttttagctac-atgataaaaggataaaaatgcaaaaatagctcgtttgattgatcgagtgtgt |
28335999 |
T |
|
| Q |
208 |
ctattatagtgtatgaac |
225 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
28336000 |
ctattatagtgtatgaac |
28336017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 66
Target Start/End: Original strand, 32702421 - 32702471
Alignment:
| Q |
16 |
gttcggttaagttttctcaattgtgattctctttgattcaagtgtttgacg |
66 |
Q |
| |
|
|||||||||||| | |||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
32702421 |
gttcggttaagtgtcctcaattgtgattctccttgtttcaagtgattgacg |
32702471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University