View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1449_high_42 (Length: 207)
Name: NF1449_high_42
Description: NF1449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1449_high_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 15 - 190
Target Start/End: Original strand, 36730577 - 36730752
Alignment:
| Q |
15 |
aaaggtggtgataagattgatatggaagaagggtcgtcattttctgctggattggcaaaacctctagtttgttaccctgttacttgttttaatccttttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36730577 |
aaaggtggtgataagattgatatggaagaagggtcgtcattttctgctggattggcaaaacctctagtttgttaccctgttacttgttttaatccttttt |
36730676 |
T |
 |
| Q |
115 |
aagttttatgattattgcatttaccatataagataaatgttgtttaggaaaataaaagtagtactactgttattac |
190 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36730677 |
aagttttatgattattgcatttaccgtataagataaatgttgtttaggaaaataaaagtagtactactgttattac |
36730752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University