View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1449_low_10 (Length: 358)
Name: NF1449_low_10
Description: NF1449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1449_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 5 - 317
Target Start/End: Original strand, 49862014 - 49862326
Alignment:
| Q |
5 |
aagaagtgacaattgatatgtgtgaaccggaattggttttgggttcgagttctggtgatgaaatgaaccagtctgtatcggaattttcttcttcttgttc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49862014 |
aagaagtgacaattgatatgtgtgaaccggaattggttttgggttcgagttctggtgaagaaatgaaccggtctgtatcggaattttcttcttcttgttc |
49862113 |
T |
|
| Q |
105 |
ttcctcatgttctgatgagaagcaatcttcattggttgacattaccgttgagattccgagaaggagtgaatccgattgcaagagttttgctgtgggagag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49862114 |
ttcctcatgttctgatgagaagcaatcttcatcggttgacattaccgttgagattccgagaaggagtgaatccgattgcaagagttttgctgtgggagag |
49862213 |
T |
|
| Q |
205 |
tcgagttgtgattcaccatcatcgtttcggtcaccaatgagtcgtgttttgtcgttcacgagaatccttagcagagagaggaaaccaagcatttctccgt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49862214 |
tcgagttgtgattcaccatcatcgtttcggtcaccaatgagtcgtgttttgtcgttcacgagaatccttagcagagagaggaaaccaagcatttctccgt |
49862313 |
T |
|
| Q |
305 |
cgttggattgtgc |
317 |
Q |
| |
|
||||||||||||| |
|
|
| T |
49862314 |
cgttggattgtgc |
49862326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University