View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1449_low_17 (Length: 300)
Name: NF1449_low_17
Description: NF1449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1449_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 7 - 282
Target Start/End: Original strand, 2926252 - 2926524
Alignment:
| Q |
7 |
gaagcaaaggagtgaatgcaaaatagttacgaggcgaaaccacctgtacttcatactttggactgtccagattcttcataaaacttgttgccgcccatcc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2926252 |
gaagcaaaggagtgaatgcaaaatagttacgaggcgaaaccacctgtacttcatactttggactgtccagattcttcataaaacttgttgccgcccatcc |
2926351 |
T |
 |
| Q |
107 |
tgttcccaacaccaccacttttttcctatcggtaaccgcctccacttccgatggataaaactcgcgatatgccacataaccaacaccactgcatcaacca |
206 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2926352 |
tgttcccagcaccaccacttttttcctatcggtaaccgcctccacttccgatggataaaactcgcgatatgccacataaccaacaccactgcatcaacca |
2926451 |
T |
 |
| Q |
207 |
cacacgcacacaaaacacatcaaatattt-tataatcacatatatatcgcaagactatgcagcatagacacagacac |
282 |
Q |
| |
|
|| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2926452 |
ca----cacacaaaacacatcaaatatttgtataatcacatatatatcgcaagactatgcatcatagacacagacac |
2926524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University