View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1449_low_24 (Length: 275)
Name: NF1449_low_24
Description: NF1449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1449_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 43366890 - 43366624
Alignment:
| Q |
1 |
tctgccttctccttcttttcatcatgctctctctcttcgctccttccccttttattgtaaatgctcttcatccttctacttcaattacattcctcattcc |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366890 |
tctgccttctctttcttttcatcatgctctctctcttcgctccttccccttttattgtaaatgctcttcatccttctacttcaattacattcctcattcc |
43366791 |
T |
 |
| Q |
101 |
attctgctgctgtgtgtaactttgattgtatttcaggataatgatttggttaaatctcgtttagattctcatcagcaatccccatttcacattccggtaa |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366790 |
attttgctgctgtgtgtaactttgattgtatttcaggataatgatttggttaaatctcgtttagattctcatcagcaatccccatttcacattccggtaa |
43366691 |
T |
 |
| Q |
201 |
tcaaacaatgttctcaccttcnnnnnnnatgcattttttgttatgttgctaatatcttccctttgcttct |
270 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
43366690 |
tcaaacaatgttctcacctt---tttttattcattttttgttatgttgctaatatcttccttttgtttct |
43366624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University