View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1449_low_29 (Length: 258)
Name: NF1449_low_29
Description: NF1449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1449_low_29 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 154 - 258
Target Start/End: Complemental strand, 5294695 - 5294591
Alignment:
| Q |
154 |
gcttatttcaacctttgaaaccaatcttggtgaatatattttcaccctcgaaactttctttggtttcctcctttgtttttcttgagtctttaccttcaac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5294695 |
gcttatttcaacctttgaaaccaatcttggtgaatatattttcaccctcgaaactttctttggtttcctcctttgtttttcttgagtctttaccttcaac |
5294596 |
T |
 |
| Q |
254 |
tcttc |
258 |
Q |
| |
|
||||| |
|
|
| T |
5294595 |
tcttc |
5294591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 5294860 - 5294778
Alignment:
| Q |
1 |
cattgaatctctaaaatcctgctttggatttgatgaacatttaatcacagcaaaactatctaattctggtttagtactaataa |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5294860 |
cattgaatctctaaaatcctgctttggatttgatgaacatttaatcacagcaaaactatctaattctggtttagtactaataa |
5294778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University