View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1449_low_31 (Length: 253)
Name: NF1449_low_31
Description: NF1449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1449_low_31 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 8 - 253
Target Start/End: Complemental strand, 52516134 - 52515889
Alignment:
| Q |
8 |
tgtcgaacaatatagtactaggaataaaagtactagaatgaaaattggggcagcttcaattgtagaaaagattgtctaatatcagtttgtttgacaacgt |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52516134 |
tgtcggacaatatagtactaggaataaaagtactagaatgaaaattggggcagcttcaattgtagaaaagattgtcaaatatcagtttgtttgacaacgt |
52516035 |
T |
|
| Q |
108 |
acaagtactagtaacaagtttgtttgacatcatgtaagtactagtaacgagagttgaccagataaaggatattccaatagtcagggtgacaaaagtaagc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52516034 |
gtaagtactagtaacaagtttgtttgacatcatgtaagtactagtaacgagagttgaccagataaaggatattccattagtcagggtgacaaaagtaagc |
52515935 |
T |
|
| Q |
208 |
caaactagtacggagagatttagtgataaacgttctacctttaaac |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52515934 |
caaactagtacggagagatttagtgataaacgttctacctttaaac |
52515889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University