View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1449_low_32 (Length: 250)

Name: NF1449_low_32
Description: NF1449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1449_low_32
NF1449_low_32
[»] chr2 (1 HSPs)
chr2 (1-63)||(9440551-9440613)


Alignment Details
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 9440613 - 9440551
Alignment:
1 aaacacataaattgattgttatgtcttttgttcaagacacaacttgtgtttggattagctgta 63  Q
    |||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||    
9440613 aaacacatagcttgattgttatgtcttttgttcaagacacaacttgtgtttggattagctgta 9440551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University