View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1449_low_34 (Length: 245)
Name: NF1449_low_34
Description: NF1449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1449_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 12 - 241
Target Start/End: Complemental strand, 38798099 - 38797870
Alignment:
| Q |
12 |
atacttgagagagaatgttgatgtgtgagttggaaataacatattggatggaagagtaaggttgaacaacatatgtgagaaggttgatatagttaatatc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38798099 |
atacttgagagagaatgttgatgtgtgagttggaaataacatattggatggaagagtaagattgaacaacatatgtgagaaggttgatatagttaatatc |
38798000 |
T |
 |
| Q |
112 |
ttagattttaggttaagatatgatgttcaaaataacttttgtggttgctcttagtcatatgannnnnnnnctaaacggtcaacattagtatgttatccca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
38797999 |
ttagattttaggttaagatatgatgttcaaactaacttttgtggttgctcttagtcatatgattttttttctaaacggtcaacattagtatgttattcca |
38797900 |
T |
 |
| Q |
212 |
tttgttaatttttaagtgtcctttggtcgt |
241 |
Q |
| |
|
||||||||||||||||||||||| ||||| |
|
|
| T |
38797899 |
gttgttaatttttaagtgtccttttgtcgt |
38797870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University