View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1449_low_42 (Length: 227)
Name: NF1449_low_42
Description: NF1449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1449_low_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 21 - 209
Target Start/End: Complemental strand, 6265434 - 6265246
Alignment:
| Q |
21 |
aattcgctagaaccctctccctccatattcatctcaccttgccttttcttttaatattaatatactagattttgttttgaagcaaataatatactagcat |
120 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6265434 |
aattcgctagaaccctcttcctccatattcatctcaccttgccttttcttttaatattaatatactagattttgttttgaagcaaataatatactagcat |
6265335 |
T |
|
| Q |
121 |
taaagtatgnnnnnnntagtcttagatatattgatcacatagtgtaagnnnnnnntggaacatttctaaggtatgatccttgagacatg |
209 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6265334 |
taaagtatgaaaaaaatagtcttagatatattgatcacatagtgtaagaaaaaaatggaacatttctaaggtatgatccttgagacatg |
6265246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University