View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14500_high_6 (Length: 433)
Name: NF14500_high_6
Description: NF14500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14500_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 53 - 420
Target Start/End: Original strand, 30756269 - 30756636
Alignment:
| Q |
53 |
atataattgaattaatttaagcacaaacctggtggtgctgaagcacataagcaccatacgaaactccattctcatcactaacaagtgttttcccaacatt |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30756269 |
atataattgaattaatttaagcacaaacctggtggtgttgaagcacataagcaccgtacgaaactccattctcatcactaacaagtgttttcccaacatt |
30756368 |
T |
 |
| Q |
153 |
agttaatgagtacttcctctcaccatccccaatatgctcttcaaacaccccataactcgccaacatacgtaacacgcgctgaagattctcggcatcgcca |
252 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
30756369 |
agtcaatgagtacttcctctcaccatccccaatatgctcttcaaacaccccataactcgccagcatacgtaacactcgctgaagattctcggcgtcgccg |
30756468 |
T |
 |
| Q |
253 |
ccgccaccaggaacaacacgcgctaggatctgctcagctgagagtggcgcgtttgcaccaccttcccatattgcgtcggcgacgttgagacggacgacgg |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30756469 |
ccgccaccaggaacaacacgcgctaggatctgagcagcagagagtggcgcgtttgcaccaccttcccatattgcgtcggcgacgttgagacggacgacgg |
30756568 |
T |
 |
| Q |
353 |
cgtgaagtgacatagggatgcttatcatgtttgctagctcgaggatggctagtcttgcttgtttttga |
420 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30756569 |
cgtgaagtgacataggaatgcttatcatgtttgctagctcgaggatggctagtcttgcttgtttttga |
30756636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University