View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14500_low_15 (Length: 263)
Name: NF14500_low_15
Description: NF14500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14500_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 32142300 - 32142538
Alignment:
| Q |
1 |
gtgaagaagagtatccaatcagaaagcaacttgagacatgacaacaagccgtctttggtttctatattttacgtaatgtaagcataagatgttagttaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32142300 |
gtgaagaagagtatccaatcagaaagcaacttgagacatgacaacaagccgtctttggtttctatattttacgtaatgtaagcataagatgttagt---- |
32142395 |
T |
|
| Q |
101 |
agttatattcaacacttgcagagtggcgcttaaattttatcgaacaaaatgcttttacatgtaatattttattgacaaactgaaaaataaaatcactaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32142396 |
---tatattcaacacttgcagagtggcgcttaaattgtatcgaacaaaatgcttttacatgtaatattttattgacaaactgaaaaataaaatcactaaa |
32142492 |
T |
|
| Q |
201 |
ccttagcattactcactcacatatattccttctcaagaaaaatctt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32142493 |
ccttagcattactcactcacatatattccttctcaagaaaaatctt |
32142538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University