View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14500_low_9 (Length: 398)
Name: NF14500_low_9
Description: NF14500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14500_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 269; Significance: 1e-150; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 15 - 283
Target Start/End: Complemental strand, 2766190 - 2765922
Alignment:
| Q |
15 |
aatatcaccttctcttagcatgcaagtaatttcatcgtcgttcataccttccaatccaagcaatgcagagtttttctttaagctctcaaatgttatcact |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2766190 |
aatatcaccttctcttagcatgcaagtaatttcatcgtcgttcataccttccaatccaagcaatgcagagtttttctttaagctctcaaatgttatcact |
2766091 |
T |
|
| Q |
115 |
ttcttctccctgtccatcaacacattaaaaccatttgccaactccttcataaacccttcacttcctaatttctccatcattgaagggaagtagtcctcaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2766090 |
ttcttctccctgtccatcaacacattaaaaccatttgccaactccttcataaacccttcacttcctaatttctccatcattgaagggaagtagtcctcaa |
2765991 |
T |
|
| Q |
215 |
aaacaaccgatccaccattcttcctcgaactcgatgccatttttgctcaattttgtgaagttgtaatat |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2765990 |
aaacaaccgatccaccattcttcctcgaactcgatgccatttttgctcaattttgtgaagttgtaatat |
2765922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 311 - 381
Target Start/End: Complemental strand, 2765894 - 2765824
Alignment:
| Q |
311 |
tagctttgcctactgttatatagcgaggaacaatgtttgttgttggaaatatgtatgtgggacgagcattt |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2765894 |
tagctttgcctactgttatatagcgaggaacaatgtttgttgttggaaatatgtatgtgggacgagcattt |
2765824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University