View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14501_high_5 (Length: 382)
Name: NF14501_high_5
Description: NF14501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14501_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 9e-52; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 25893403 - 25893260
Alignment:
| Q |
1 |
taaacaaattcatttctaaacaaattcgtcnnnnnnnccaaataaaagttggaaaatgttggtccaccaacacttcaagtcagaaacaatcactcatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25893403 |
taaacaaattcatttctaaacaaattcgtcaaaaaaaccaaataaaagttggaaaatgttggtccaccaacacttcaagtcagaaacaatcactcgtgat |
25893304 |
T |
 |
| Q |
101 |
cttcatgtatcaaatgatgacgatatgtaccccagtcacgtgcaaaa |
147 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
25893303 |
cttcatgtatcaa---atgacgatatgtaacccagtcacgtgcaaaa |
25893260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 244 - 353
Target Start/End: Complemental strand, 25893211 - 25893102
Alignment:
| Q |
244 |
gagctacgaaaatatctctattttagcccatatgaatattagaagaggtaaaagttttggaaactattacgtactctcacaaattaaaatgtattggtac |
343 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
25893211 |
gagctacgaaaatatctctattttagctcatatgaatattagaagaggtaaaagttttggaaactattacgtacggtcacaaattaaaatgtattggtgc |
25893112 |
T |
 |
| Q |
344 |
tattgcttcg |
353 |
Q |
| |
|
|||||||||| |
|
|
| T |
25893111 |
tattgcttcg |
25893102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 151 - 181
Target Start/End: Complemental strand, 25893240 - 25893210
Alignment:
| Q |
151 |
aggcaccgttcttaaggatatatttgcccga |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25893240 |
aggcaccgttcttaaggatatatttgcccga |
25893210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University