View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14501_low_10 (Length: 273)
Name: NF14501_low_10
Description: NF14501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14501_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 156 - 251
Target Start/End: Original strand, 29486884 - 29486979
Alignment:
| Q |
156 |
cttcagtatatagttcagtttgattttgcacatcagaaggactgatatcaacataaaccggaataataagtctacatgtatcaaggttgttgttct |
251 |
Q |
| |
|
||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| | | |||||||||||| |
|
|
| T |
29486884 |
cttcactatatggtacagtttgattttgcacatcagaaggactgatatcaacataaaccggaagaataagtctatatggtttagggttgttgttct |
29486979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 44 - 126
Target Start/End: Original strand, 29486805 - 29486887
Alignment:
| Q |
44 |
tacccgtgtttcaaattccaggcggacaagttagctacatgagatagagcgttcctccatttaaacaatttattcttgtcttc |
126 |
Q |
| |
|
||||| ||||| |||||||| |||| ||||||||||||| |||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
29486805 |
tacccatgtttgaaattccacgcgggcaagttagctacacgagatagagcgttcctccatttaatcaatttattattgtcttc |
29486887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University