View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14501_low_6 (Length: 382)

Name: NF14501_low_6
Description: NF14501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14501_low_6
NF14501_low_6
[»] chr8 (3 HSPs)
chr8 (1-147)||(25893260-25893403)
chr8 (244-353)||(25893102-25893211)
chr8 (151-181)||(25893210-25893240)


Alignment Details
Target: chr8 (Bit Score: 104; Significance: 9e-52; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 25893403 - 25893260
Alignment:
1 taaacaaattcatttctaaacaaattcgtcnnnnnnnccaaataaaagttggaaaatgttggtccaccaacacttcaagtcagaaacaatcactcatgat 100  Q
    ||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
25893403 taaacaaattcatttctaaacaaattcgtcaaaaaaaccaaataaaagttggaaaatgttggtccaccaacacttcaagtcagaaacaatcactcgtgat 25893304  T
101 cttcatgtatcaaatgatgacgatatgtaccccagtcacgtgcaaaa 147  Q
    |||||||||||||   ||||||||||||| |||||||||||||||||    
25893303 cttcatgtatcaa---atgacgatatgtaacccagtcacgtgcaaaa 25893260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 244 - 353
Target Start/End: Complemental strand, 25893211 - 25893102
Alignment:
244 gagctacgaaaatatctctattttagcccatatgaatattagaagaggtaaaagttttggaaactattacgtactctcacaaattaaaatgtattggtac 343  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||| |    
25893211 gagctacgaaaatatctctattttagctcatatgaatattagaagaggtaaaagttttggaaactattacgtacggtcacaaattaaaatgtattggtgc 25893112  T
344 tattgcttcg 353  Q
    ||||||||||    
25893111 tattgcttcg 25893102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 151 - 181
Target Start/End: Complemental strand, 25893240 - 25893210
Alignment:
151 aggcaccgttcttaaggatatatttgcccga 181  Q
    |||||||||||||||||||||||||||||||    
25893240 aggcaccgttcttaaggatatatttgcccga 25893210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University