View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14502_high_10 (Length: 240)
Name: NF14502_high_10
Description: NF14502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14502_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 4 - 212
Target Start/End: Complemental strand, 19151626 - 19151419
Alignment:
| Q |
4 |
agagattgcgggattggctttttgttgtttggagttgatggagcatttataaataaaatattagtaccattgatttgatattgagattatattttcaatt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19151626 |
agagattgcgggattggctttttgttgtttggagttgatggagcatttataaataaaatattagtaccattgatttgatattgagattatattttcaatt |
19151527 |
T |
|
| Q |
104 |
ggnnnnnnnnntttgtcgttcttctttaaattgttagtaggttcacctaaacttttggtaacaaagaaaaatgttgttggtatgtttagaatgaaaaatg |
203 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
19151526 |
ggaaaaaaaaa-ttgtcgttcttctttaaattgttagtaggttcacctaaacttttggtaacaaaaaaaaatgttgttggtatgtttaggatgaaaaatg |
19151428 |
T |
|
| Q |
204 |
aagaaaaat |
212 |
Q |
| |
|
||||||||| |
|
|
| T |
19151427 |
aagaaaaat |
19151419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University