View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14502_high_5 (Length: 342)
Name: NF14502_high_5
Description: NF14502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14502_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 319
Target Start/End: Original strand, 33255894 - 33256212
Alignment:
| Q |
1 |
ttattatataatcaagagtctacattcttccccttaacccatgattcttttctttggctatccccccggcagtctttttgccatgtccattacgtctctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33255894 |
ttattatataatcaagagtctacattcttccccttaacccatgattcttttctttggctatccccccggcagtctttttgccatgtccattacgtctctg |
33255993 |
T |
|
| Q |
101 |
tcttgaaaaaggcctaacatcttcaaagttcaaaccatgcgttctgcctaatgtcactttgaaatcaatgtttaagtcttgcctcaattttcaaatcaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33255994 |
tcttgaaaaaggcctaacatcttcaaagttcaaaccatgcgttctgcctaatgtcactttgaaatcaatgtttaagtcttgccgcaattttcaaatcaat |
33256093 |
T |
|
| Q |
201 |
gtcacattgtgatcattttaggagagaccaaacggacaaggaacagtatgatgcttcaaaatttatttgggaattaagagtttgctagccaactcaaata |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33256094 |
gtcacattgtgatcattttaggagagaccaaacggacaaggaacagtatgatgctccaaaatttatttgggaattaagagtttgctagccaactcaaata |
33256193 |
T |
|
| Q |
301 |
aattattcttcttcttttc |
319 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33256194 |
aattattcttcttcttttc |
33256212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University