View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14502_high_7 (Length: 286)
Name: NF14502_high_7
Description: NF14502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14502_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 21 - 274
Target Start/End: Complemental strand, 39985267 - 39985014
Alignment:
| Q |
21 |
ttttgtttttatcaaatgaatgaagcatcaatttttggtttgtgttggtggagccagagggtctcaccaacaagtgaagaaattatgaaaaaagagaaaa |
120 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39985267 |
ttttgattttatcaaatgaatgaagcatcaatttttggtttgtgttggtggagccagagggtctcaccaacaagtgaagaaattatgaaaaaagagaaaa |
39985168 |
T |
 |
| Q |
121 |
gataaagctaaggacaaagcaaataacaagtgtgggttctgttactatcctaccttgtccccccacccannnnnnnnnnnnnnnnnnnnnacaagtacaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39985167 |
gataaagctaaggacaaagcaaataacaagtgtgtgttctgttactatcctaccttgtccccccacccaacacacactcacacacacacaacaagtacaa |
39985068 |
T |
 |
| Q |
221 |
aagccactcacaaaattaacttttgattcaattgtctattccttttcctgttcc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39985067 |
aagccactcacaaaattaacttttgattcaattgtctattccttttcctgttcc |
39985014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University