View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14502_low_12 (Length: 269)
Name: NF14502_low_12
Description: NF14502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14502_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 45521239 - 45520982
Alignment:
| Q |
1 |
aattgggaaggaggatcatgatgacttcaccttgttggagtcccaatttgtgaagaccagaggcaactttacgggaggtgagttggacgtcgtggtaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45521239 |
aattgggaaggaggatcatgatgacttcaccttgttggagtcccaatttgtgaagaccagaggcaactttacgggaggtgagttggacgtcgtggtaggt |
45521140 |
T |
 |
| Q |
101 |
gtagacctttccagtgggggcattgatgagacatggacgtgaaccgaattgggagagattttcaaaacaatatgaatgaagcggtagatgttttgggatg |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45521139 |
gtagacctttccggtgggggcattgatgagacatggacgtgaaccgaattgggagagattttcaaaacaatatgaatgaagcggtagatggtttgggatg |
45521040 |
T |
 |
| Q |
201 |
tatatgtctggtagtttcgacttgaatattatttcctttgtttcttgtttagatgatg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45521039 |
tatatgtctggtagtttcgacttgaatattatttcctttgtttcttgtttagatgatg |
45520982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 202
Target Start/End: Complemental strand, 349847 - 349765
Alignment:
| Q |
120 |
gcattgatgagacatggacgtgaaccgaattgggagagattttcaaaacaatatgaatgaagcggtagatgttttgggatgta |
202 |
Q |
| |
|
||||||||||| || ||||||||||| ||| || ||||||||||| |||||||||||||| || || ||||| || ||||| |
|
|
| T |
349847 |
gcattgatgaggcaaggacgtgaaccatattttgatagattttcaaagcaatatgaatgaagaggaaggtgtttgggaatgta |
349765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University