View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14502_low_16 (Length: 228)
Name: NF14502_low_16
Description: NF14502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14502_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 18 - 182
Target Start/End: Complemental strand, 42934497 - 42934333
Alignment:
| Q |
18 |
gagtaattcagtgaggtttacgaaatctggtgtaggtgctggtgctggagccggagttggactctcgatggggggagagggtggacttacagttttagca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42934497 |
gagtaattcagtgaggtttacgaaatctggtgtaggtgctggtgctggagccggagttggactctcagcggggggagagggtggacttacagttttagca |
42934398 |
T |
|
| Q |
118 |
aatgccgatgagctcagaagcagcagagtgcacacaagaaaaatcattgaaaccttcatctttga |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42934397 |
aatgccgatgagctcagaagcagcagagtggacacaagaaaaatcattgaaaccttcatctttga |
42934333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University