View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14502_low_17 (Length: 227)
Name: NF14502_low_17
Description: NF14502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14502_low_17 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 6 - 227
Target Start/End: Original strand, 41732503 - 41732728
Alignment:
| Q |
6 |
agttattttaagctattgatcatagtttgtagtttgagcagcacctgagcaatctgggttcacaacggaatgtgaattaggatgaaatgcaattttcact |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41732503 |
agttattttaagctattgatcatagtttgtagtttgagcagcaacggagcaatctgggttcacaacggaatgtgaattaggatgaaatgcaattttcact |
41732602 |
T |
 |
| Q |
106 |
agttaaccaatgactagtttcttgcactagaaatttcacaagttatgaat----ctcaatcattagttttagattaaatgactcacatgacacaactggt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41732603 |
agttaaccaatgactagtttcttgcactagaaatttcacaagttatgaatctcactcaatcattagttttagattaaatgactcacataacacaactggt |
41732702 |
T |
 |
| Q |
202 |
caatcaattttaaaggatcttgacta |
227 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41732703 |
caatcaattttaaaggatcttgacta |
41732728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University