View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14503_high_3 (Length: 225)
Name: NF14503_high_3
Description: NF14503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14503_high_3 |
 |  |
|
| [»] scaffold0687 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0471 (1 HSPs) |
 |  |  |
|
| [»] scaffold0136 (1 HSPs) |
 |  |  |
|
| [»] scaffold0532 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 37)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 107 - 208
Target Start/End: Original strand, 47370544 - 47370645
Alignment:
| Q |
107 |
ttgtcacgttatcaaatttgattatcaaaataattggctcctcgagaattttaaaacagggaaccaaaatttaacaattaaaaatggcaggactatgatt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47370544 |
ttgtcacgttatcaaatttgattatcaaaatcattggttcctcgagaattttaaaaaagggaaccaaaatttaacaattaaaaatggcaggactataatt |
47370643 |
T |
 |
| Q |
207 |
ac |
208 |
Q |
| |
|
|| |
|
|
| T |
47370644 |
ac |
47370645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 39020185 - 39020120
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
39020185 |
actttttctctcatactcacattactttttactttatctctctattgctatggtttccgtgtcaat |
39020120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 43905018 - 43905083
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
43905018 |
actttctctctcatactcacattactttttactttatctctctattgttatggtttctgtgtcaat |
43905083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 390854 - 390919
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||| | ||||| ||| |||||||||||||| |
|
|
| T |
390854 |
actttttctctcatactcacattattttttactttatctctctattgctatagtttccgtgtcaat |
390919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 37508524 - 37508459
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
37508524 |
actttctctctcatactcacattactttttactttatctctctattgctatggtttccgtgccaat |
37508459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 49363277 - 49363212
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
49363277 |
actttctctctcatactcacattactttttactttatctctctattgatatggtttccgtgccaat |
49363212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 24645401 - 24645461
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| | ||||||| |||||| |||| |
|
|
| T |
24645401 |
actttttctctcatactcacattactttttactttatctctctattgttttggttttcgtg |
24645461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 7 - 66
Target Start/End: Original strand, 32767727 - 32767786
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
32767727 |
tctctcatactcacattattttttactttatctctctattgctatggtttccgtgtcaat |
32767786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 11 - 66
Target Start/End: Complemental strand, 39671113 - 39671058
Alignment:
| Q |
11 |
tcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||| |||||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
39671113 |
tcatactcacattactttttactttatctctctattgttatgatttccgtgtcaat |
39671058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 8821675 - 8821740
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| ||||||||| |||||||| |
|
|
| T |
8821675 |
actttctctctcatactcacattattttttactttatctctctattgctatggtttctgtgtcaat |
8821740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 10206999 - 10206934
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | | ||| ||||||||||||| |||| |
|
|
| T |
10206999 |
actttctctctcatactcacattactttttactttatctctctgttgctatggtttccgtgccaat |
10206934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 11633658 - 11633723
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||||||||| |||| |||||||||||||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
11633658 |
actttctctctcatattcacattactttttactttatctctctattgctatggtttccgtgccaat |
11633723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 24482989 - 24482929
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||||| |||||| |||| |
|
|
| T |
24482989 |
actttctctctcatactcacattactttttactttatctctatattgttttggttttcgtg |
24482929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 39907572 - 39907508
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaa |
65 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||| | | ||||| |||| |||||||||||| |
|
|
| T |
39907572 |
actttttctctcatactcacattattttttactttatttctctattgctatgatttccgtgtcaa |
39907508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 50206996 - 50206936
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||||| |||||| |||| |
|
|
| T |
50206996 |
actttctctctcatactcacattactttttactttatctctctattgttttggttttcgtg |
50206936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 44677504 - 44677445
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
44677504 |
tctctcatactcacattattttttactttatctctctattgctatggtttccgtgccaat |
44677445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 66
Target Start/End: Original strand, 54027993 - 54028052
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||||||||| || ||| |||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
54027993 |
tctctcatacttacattattttttactttatctctctattgttatgatttccgtgtcaat |
54028052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 26996361 - 26996424
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| ||||||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
26996361 |
actttctctctcatactcacattattttttactttatc--tctattgctatggtttccgtgtcaat |
26996424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 34057979 - 34057941
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatct |
39 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34057979 |
actttctctctcatactcacgttactttttactttatct |
34057941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 3 - 61
Target Start/End: Original strand, 46253669 - 46253727
Alignment:
| Q |
3 |
tttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
46253669 |
tttttctctcatactcacattactttttactttatctctctattgctttggttttcgtg |
46253727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 30909074 - 30909139
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||||| ||| |||| |||||||||||||||||| | |||||||||||||| |||| |||| |
|
|
| T |
30909074 |
actttctctcttatattcacattactttttactttatctctctattgttatggttttcgtgccaat |
30909139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 49417620 - 49417685
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||| ||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
49417620 |
actttctctctcatactcacattattttttattttatctctctattgctatggtttccgtgccaat |
49417685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 55013048 - 55013112
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||||| ||| |||| |||||||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
55013048 |
actttctctcttatattcacattacttttta-tttatctctttattgctatggtttccgtgtcaat |
55013112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 47
Target Start/End: Complemental strand, 16675546 - 16675506
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattg |
47 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
16675546 |
tctctcatattcacgttactttttactttatctctttattg |
16675506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 20080118 - 20080177
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
20080118 |
actttctctctcatactcacatta-tttttactttatctctctattgttttggtttccgtg |
20080177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 39697248 - 39697188
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
39697248 |
actttctctctcatactcacattactttttactttatctctctattgctttggttttcgtg |
39697188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 59 - 110
Target Start/End: Original strand, 47370467 - 47370519
Alignment:
| Q |
59 |
gtgtcaatttaacaacccagtttt-taaggctttcattaaatagacattttgt |
110 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||| ||||||| |
|
|
| T |
47370467 |
gtgtcaatttaacaacccatttttttaaggctttcgttaaatagatattttgt |
47370519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 55400044 - 55400104
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
55400044 |
actttctctctcatactcacattactttttactttatctctctattgctttggttttcgtg |
55400104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 3281742 - 3281687
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggttt |
56 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||| ||||||| | |||||| |
|
|
| T |
3281742 |
actttctctcttatactcacattactttttactttatctctttattgctttggttt |
3281687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 66
Target Start/End: Original strand, 33375911 - 33375970
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| | ||||| ||| ||||||||| |||| |
|
|
| T |
33375911 |
tctctcatactcacattattttttactttatctctctattgctatagtttccgtgccaat |
33375970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 46019507 - 46019562
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggttt |
56 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| | |||||| |
|
|
| T |
46019507 |
actttctctctcatactcacattactttttactttatctctctattgctttggttt |
46019562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 21005202 - 21005164
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatct |
39 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
21005202 |
actttctctcttatactcacgttactttttactttatct |
21005164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 66
Target Start/End: Complemental strand, 46984650 - 46984593
Alignment:
| Q |
9 |
tctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||||||||| ||| ||| |||||||||| | ||||||||||||||||||| |||| |
|
|
| T |
46984650 |
tctcatactcatattattttctactttatctctctattgttatggtttccgtgccaat |
46984593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 19149034 - 19149090
Alignment:
| Q |
1 |
actttttctctcatactcacgtta-ctttttactttatctatttattgttatggttt |
56 |
Q |
| |
|
||||| |||||||||||||| ||| ||||||||||| ||| ||||||||| |||||| |
|
|
| T |
19149034 |
actttctctctcatactcacattatctttttactttctctctttattgttttggttt |
19149090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 34662051 - 34662115
Alignment:
| Q |
1 |
actttttctctcatactcacgttac-tttttactttatctatttattgttatggtttccgtgtca |
64 |
Q |
| |
|
||||| |||||||||||||| ||| ||||||||||||||||||||| || || ||| ||||||| |
|
|
| T |
34662051 |
actttatctctcatactcacattatatttttactttatctatttattattttgattttcgtgtca |
34662115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 46852158 - 46852098
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||| | | ||||||| |||||| |||| |
|
|
| T |
46852158 |
actttctctctcatactcatattactttttactttatttgtctattgttttggttttcgtg |
46852098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 61
Target Start/End: Complemental strand, 50638373 - 50638317
Alignment:
| Q |
5 |
tttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
|||||||||||||||| | | |||||||||||||| | ||||| | ||||||||||| |
|
|
| T |
50638373 |
tttctctcatactcacataattttttactttatctctctattgctttggtttccgtg |
50638317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 9e-20; HSPs: 16)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 3610987 - 3610922
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
3610987 |
actttttctctcatactcacattactttttactttatctctctattgctatggtttccgtgtcaat |
3610922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 34504065 - 34504130
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| |||||||| ||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
34504065 |
actttctctctcatactcacattacttttcactttatctctctattgctatggtttccgtgtcaat |
34504130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 11547549 - 11547490
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
11547549 |
tctctcatactcacattattttttactttatctctctattgctatggtttccgtgtcaat |
11547490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 2075477 - 2075412
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||||||| ||||||||| |||| |
|
|
| T |
2075477 |
actttctctctcatactcacattattttttactttatctctctattgttatagtttccgtgccaat |
2075412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 754464 - 754404
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
754464 |
actttttctctcatactcacattactttttactttatctctctattgctttggttttcgtg |
754404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 3199005 - 3199070
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||| | ||||||| | ||||| |||||||||||||||||| |
|
|
| T |
3199005 |
actttctctctcatactcacattatttttcattttatctctatattgctatggtttccgtgtcaat |
3199070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 5028292 - 5028231
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgt |
62 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||| ||||||| | |||||| ||||| |
|
|
| T |
5028292 |
actttctctcttatactcacattactttttactttatctctttattgctttggttttcgtgt |
5028231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 13658877 - 13658942
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||| |||||||||| ||| ||||||||| |||| | ||||| |||||||||||||||||| |
|
|
| T |
13658877 |
actttctctttcatactcacattattttttacttgatctctctattgatatggtttccgtgtcaat |
13658942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 20822894 - 20822834
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
20822894 |
actttctctctcatactcacattactttttactttatctctctattgctttggttttcgtg |
20822834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 35213587 - 35213527
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
35213587 |
actttctctctcatactcacattactttttactttatctctctattgctttggttttcgtg |
35213527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 61
Target Start/End: Complemental strand, 2777336 - 2777283
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||| | ||||| ||||||||||||| |
|
|
| T |
2777336 |
tctctcatactcacattactttttac-ttatctctctattgctatggtttccgtg |
2777283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 4820296 - 4820346
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttat |
51 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||||||| |
|
|
| T |
4820296 |
actttctctctcatactcacattattttttactttatctctctattgttat |
4820346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 13143408 - 13143370
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatct |
39 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
13143408 |
actttctctctcatactcacattactttttactttatct |
13143370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 18141327 - 18141289
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatct |
39 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
18141327 |
actttctctctcatactcacattactttttactttatct |
18141289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 60
Target Start/End: Complemental strand, 22341194 - 22341141
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgt |
60 |
Q |
| |
|
|||||||||||||| | | |||||||||||||| | ||||| |||||||||||| |
|
|
| T |
22341194 |
tctctcatactcacatcattttttactttatctctctattgctatggtttccgt |
22341141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 14986745 - 14986705
Alignment:
| Q |
26 |
tttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||| |||| |
|
|
| T |
14986745 |
tttttactttatctctttattgctatggtttccgtgccaat |
14986705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 25)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 29163002 - 29162937
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||||||||||||||||| |||| |
|
|
| T |
29163002 |
actttctctctcatactcacattactttttactttatctctctattgttatggtttccgtgccaat |
29162937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 11353000 - 11352939
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgt |
62 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| ||||||| | |||||| ||||| |
|
|
| T |
11353000 |
actttctctctcatactcacattactttttactttatctctttattgctttggttttcgtgt |
11352939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 13162964 - 13163029
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
13162964 |
actttctctctcatactcatattactttttactttatctctctattgctatggtttccgtgccaat |
13163029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 38779770 - 38779705
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||| |||| | ||||| ||||||||||||| |||| |
|
|
| T |
38779770 |
actttttctctcatactcacattattttttacttcatctctctattgctatggtttccgtgccaat |
38779705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 39231754 - 39231689
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
39231754 |
actttctctctcatactcacattattttttactttatctctctattgctatggtttccgtgccaat |
39231689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 39823854 - 39823919
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||||||||||| |||||| ||| |||||||||||||| | ||||||||| ||||||||||||| |
|
|
| T |
39823854 |
actttttctctcacactcacattattttttactttatctttctattgttataatttccgtgtcaat |
39823919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 9 - 66
Target Start/End: Complemental strand, 41666940 - 41666883
Alignment:
| Q |
9 |
tctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||| |||||||||||||||||| | |||||||||||| |||||| |||| |
|
|
| T |
41666940 |
tctcatactcacattactttttactttatctctctattgttatggtgtccgtgccaat |
41666883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 47078277 - 47078212
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
47078277 |
actttctctctcatactcacattattttttactttatctctctattgctatggtttccgtgccaat |
47078212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 3 - 66
Target Start/End: Original strand, 32815215 - 32815278
Alignment:
| Q |
3 |
tttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||| | ||||| ||||||||| ||| |||| |
|
|
| T |
32815215 |
tttttctctcatactcacattattttttactttatctctctattgctatggtttctgtgccaat |
32815278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 3 - 56
Target Start/End: Original strand, 20482574 - 20482627
Alignment:
| Q |
3 |
tttttctctcatactcacgttactttttactttatctatttattgttatggttt |
56 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||| | ||||||| |||||| |
|
|
| T |
20482574 |
tttttctctcatactcactttattttttactttatctctctattgttttggttt |
20482627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 36019462 - 36019526
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| ||||||||| |||||||| |
|
|
| T |
36019462 |
actttctctctcatactcacatta-tttttactttatctctatattgctatggtttctgtgtcaat |
36019526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 39332030 - 39332095
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||| | ||||| |||| |||||||| |||| |
|
|
| T |
39332030 |
actttctctcttatactcacattactttttactttatctctctattgctatgatttccgtgccaat |
39332095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 40353309 - 40353374
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||| ||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
40353309 |
actttctctctcatactcacattattttttattttatctctctattgctatggtttccgtgccaat |
40353374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 44184585 - 44184525
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
44184585 |
actttctctctcatactcacattactttttactttatctctctattgctttggttttcgtg |
44184525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 3062375 - 3062430
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggttt |
56 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||| | ||||||| |||||| |
|
|
| T |
3062375 |
actttctctcttatactcacattactttttactttatctctctattgttttggttt |
3062430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 37808784 - 37808725
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||||||||| || ||| |||||||||||||| | |||||||||| |||||||| |||| |
|
|
| T |
37808784 |
tctctcatacttacattattttttactttatctctctattgttatgctttccgtgccaat |
37808725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 61
Target Start/End: Complemental strand, 21023133 - 21023083
Alignment:
| Q |
11 |
tcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||| ||| |||||||||||||| | ||||||||||||||||||| |
|
|
| T |
21023133 |
tcatattcacattattttttactttatctctctattgttatggtttccgtg |
21023083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 61
Target Start/End: Complemental strand, 33180730 - 33180676
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| | ||||||| |||||| |||| |
|
|
| T |
33180730 |
tctctcatactcacattattttttactttatctctctattgttttggttttcgtg |
33180676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 19786105 - 19786040
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||| ||||||||| |||||||||||||||||| | ||||| | |||||| |||| |||| |
|
|
| T |
19786105 |
actttctctcacatactcacattactttttactttatctctctattgctctggttttcgtgccaat |
19786040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 41399189 - 41399128
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgt |
62 |
Q |
| |
|
||||| ||||||||||||| ||| |||||||||||||| | ||||||| |||||| ||||| |
|
|
| T |
41399189 |
actttatctctcatactcatattattttttactttatctctctattgttttggttttcgtgt |
41399128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 46532547 - 46532608
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgt |
62 |
Q |
| |
|
||||| || ||||||||||| ||| |||||||||||||| | ||||||| |||||| ||||| |
|
|
| T |
46532547 |
actttctcactcatactcacattattttttactttatctctctattgttttggttttcgtgt |
46532608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 13906458 - 13906418
Alignment:
| Q |
26 |
tttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||| |||| |
|
|
| T |
13906458 |
tttttactttatctctctattgttatggtttccgtgccaat |
13906418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 41893960 - 41894020
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| ||| |||||||||| |||||||||||||||||| | | ||||| |||||| |||| |
|
|
| T |
41893960 |
actttctctttcatactcacattactttttactttatctctctgttgttttggttttcgtg |
41894020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 43573569 - 43573509
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| ||||||||| |||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
43573569 |
actttctctctcatattcacattactttttactttatctctctattgctttggttttcgtg |
43573509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 46653088 - 46653048
Alignment:
| Q |
26 |
tttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
46653088 |
tttttattttatctctttattgctatggtttccgtgtcaat |
46653048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 23)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 41569422 - 41569363
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgt |
60 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| | ||||| |||||||||||| |
|
|
| T |
41569422 |
actttctctctcatactcacgttactttttactttatctctctattgctatggtttccgt |
41569363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 9634462 - 9634402
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| | ||||||| |||||| |||| |
|
|
| T |
9634462 |
actttttctctcatactcacattactttttactttatctctatattgttttggttttcgtg |
9634402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 6170675 - 6170735
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
6170675 |
actttctctctcatactcacgttactttttactttatctctctattgctttggttttcgtg |
6170735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 66
Target Start/End: Original strand, 35705545 - 35705604
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||| ||||||| |||||||| ||||||||| |
|
|
| T |
35705545 |
tctctcatactcacattatattttactttatctctttattgctatggttttcgtgtcaat |
35705604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 7 - 61
Target Start/End: Complemental strand, 35589407 - 35589353
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | ||||||| |||||| |||| |
|
|
| T |
35589407 |
tctctcatactcacattactttttactttatctctctattgttttggttttcgtg |
35589353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 42223967 - 42223913
Alignment:
| Q |
12 |
catactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||||||| ||| |||||| ||||||| | |||||||||||||||||||||||| |
|
|
| T |
42223967 |
catactcacattaatttttattttatctttctattgttatggtttccgtgtcaat |
42223913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 433895 - 433960
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| | | |||||||||||||| | ||||| |||| ||||||||||||| |
|
|
| T |
433895 |
actttctctctcatactcacatcattttttactttatctctctattgctatgatttccgtgtcaat |
433960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 18176985 - 18177050
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| ||||| |||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
18176985 |
actttctctctcatactcacattatttttttctttatctctctattgctatggtttccgtgccaat |
18177050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 6941013 - 6941053
Alignment:
| Q |
26 |
tttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
6941013 |
tttttactttatctctttattgttatggtttccgtgccaat |
6941053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 6999094 - 6999034
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
6999094 |
actttctctctcatactcacattactttttactttatctctctattgctttggttttcgtg |
6999034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 13347841 - 13347781
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
13347841 |
actttctctctcatactcacattactttttactttatctctctattgctttggttttcgtg |
13347781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 56
Target Start/End: Original strand, 29712026 - 29712078
Alignment:
| Q |
4 |
ttttctctcatactcacgttactttttactttatctatttattgttatggttt |
56 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| | ||||| | |||||| |
|
|
| T |
29712026 |
ttttctctcatactcacattactttttactttatctctctattgctttggttt |
29712078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 42678794 - 42678854
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| | ||||||||||| |
|
|
| T |
42678794 |
actttctctctcatactcacattattttttactttatctctctattgctttggtttccgtg |
42678854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 62
Target Start/End: Original strand, 10711775 - 10711830
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtgt |
62 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | ||||| | |||||| ||||| |
|
|
| T |
10711775 |
tctctcatactcacattactttttactttatctctctattgctttggttttcgtgt |
10711830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 29684638 - 29684591
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgt |
48 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
29684638 |
actttctctctcatactcaccttactttttactttatctttctattgt |
29684591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 13765445 - 13765483
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatct |
39 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
13765445 |
actttctctctcatactcatgttactttttactttatct |
13765483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 18723639 - 18723685
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattg |
47 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| ||||||| |
|
|
| T |
18723639 |
actttctctctcatactcacattattttttactttatctctttattg |
18723685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 42866795 - 42866833
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatct |
39 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
42866795 |
actttttctctcatactcacattattttttactttatct |
42866833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 13 - 66
Target Start/End: Original strand, 29879899 - 29879952
Alignment:
| Q |
13 |
atactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||| ||| |||| ||||||||| | |||||||||||||| ||||||||| |
|
|
| T |
29879899 |
atactcacattatttttaactttatctctctattgttatggtttacgtgtcaat |
29879952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 34119678 - 34119617
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgt |
62 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||||| || ||| ||||| |
|
|
| T |
34119678 |
actttctctctcatactcacattattttttactttatctctctattgttttgattttcgtgt |
34119617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 2563749 - 2563809
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| ||||||||||| || || ||||||||||||||| | ||||||| |||||| |||| |
|
|
| T |
2563749 |
actttctctctcatacttacatttctttttactttatctttctattgttttggttttcgtg |
2563809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 9377501 - 9377561
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| ||||||||| |||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
9377501 |
actttctctctcatattcacattactttttactttatctctctattgctttggttttcgtg |
9377561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 28245773 - 28245833
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
28245773 |
actttctctctcatactcacattattttttactttatctctctattgctttggttttcgtg |
28245833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 32)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 30136041 - 30135976
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||||||||| |||| |||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
30136041 |
actttctctctcatattcacattactttttactttatctctttattactatggtttccgtgtcaat |
30135976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 3 - 66
Target Start/End: Complemental strand, 40739936 - 40739873
Alignment:
| Q |
3 |
tttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||||||||||| |||| ||| |||||||||||||| | ||||||||||||||||||| |||| |
|
|
| T |
40739936 |
tttttctctcatattcacattattttttactttatctctctattgttatggtttccgtgccaat |
40739873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 6968259 - 6968193
Alignment:
| Q |
1 |
actttttctctcatactcacgttacttttt-actttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||||||||| ||||||||| | |||||||||||||||||| ||||| |
|
|
| T |
6968259 |
actttctctctcatactcacattacttttttactttatctgtctattgttatggtttccgtatcaat |
6968193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 7956033 - 7955975
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccg |
59 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| ||||||||||| |
|
|
| T |
7956033 |
actttctctctcatactcacattactttttactttatctctctattgctatggtttccg |
7955975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 7592894 - 7592959
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||||||||| |||| ||| |||||||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
7592894 |
actttatctctcatagtcacattattttttactttatctctctattgctatggtttccgtgtcaat |
7592959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 12707194 - 12707255
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgt |
62 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||| | ||||||| |||||| ||||| |
|
|
| T |
12707194 |
actttctctctcatactcacgttactttttaatttatctctctattgttttggttttcgtgt |
12707255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 45529272 - 45529207
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
45529272 |
actttctctctcatactcacattattttttactttatctctctattgctatggtttccgtgccaat |
45529207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 11658026 - 11657966
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||| ||||||| | |||| |||||||||||||| |
|
|
| T |
11658026 |
actttctctctcatactcacattactttttattttatctctctattattatggtttccgtg |
11657966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 33589250 - 33589191
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| | |||||||||||||||||| |||| |
|
|
| T |
33589250 |
tctctcatactcacattattttttactttatctctccattgttatggtttccgtgccaat |
33589191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 66
Target Start/End: Original strand, 36110193 - 36110248
Alignment:
| Q |
11 |
tcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||| |||||||||||||||||| | |||||||||||||| |||| |||| |
|
|
| T |
36110193 |
tcatactcacattactttttactttatctctctattgttatggttttcgtgccaat |
36110248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 66
Target Start/End: Original strand, 41521019 - 41521078
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||| ||||||||| |||||||| |
|
|
| T |
41521019 |
tctctcatactcacattattttttactttatctcgttattgctatggtttctgtgtcaat |
41521078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 7 - 61
Target Start/End: Complemental strand, 1871634 - 1871580
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
|||||||||||||| ||| |||| ||||||||| | ||||||||||||||||||| |
|
|
| T |
1871634 |
tctctcatactcacattatttttcactttatctctctattgttatggtttccgtg |
1871580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 1633916 - 1633851
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| ||||||||| ||| |||| |
|
|
| T |
1633916 |
actttctctctcatactcacattattttttactttatctctctattgctatggtttctgtgccaat |
1633851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 11017850 - 11017907
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttcc |
58 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||||||| |||||| |
|
|
| T |
11017850 |
actttctctctcatactcacattattttttactttatctctctattgttatcgtttcc |
11017907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 16966830 - 16966895
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| ||| |||||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
16966830 |
actttctctctcatactcacattattttctactttatctctctattgctatggtttccgtgccaat |
16966895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 56
Target Start/End: Original strand, 31596999 - 31597048
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggttt |
56 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | ||||||| |||||| |
|
|
| T |
31596999 |
tctctcatactcacattactttttactttatctctctattgttttggttt |
31597048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 32843967 - 32843903
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||| ||||||| ||| |||||||||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
32843967 |
actttttctctcttactcacatta-tttttactttatctctctattgctatggtttccgtgccaat |
32843903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 36531640 - 36531705
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||||||| ||||||||| ||| |||||||||||||| | |||||||||| |||||||| |||| |
|
|
| T |
36531640 |
actttttctttcatactcatattattttttactttatctctctattgttatgatttccgtgccaat |
36531705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 37783997 - 37783932
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||| | ||||| || | ||||||||||||| |
|
|
| T |
37783997 |
actttctctctcatactcagattactttttactttatctctctattgctaggatttccgtgtcaat |
37783932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 2733033 - 2733092
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||| | |||| || ||||||||||| |
|
|
| T |
2733033 |
actttttctctcatactcacatta-tttttactttatctctctattattttggtttccgtg |
2733092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 4994426 - 4994486
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| | ||||||||||| |
|
|
| T |
4994426 |
actttatctctcatactcacattattttttactttatctctctattgatttggtttccgtg |
4994486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 4658289 - 4658234
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggttt |
56 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| | ||||| | |||||| |
|
|
| T |
4658289 |
actttttctctcatacttacattactttttactttatctctctattgctttggttt |
4658234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 66
Target Start/End: Original strand, 7478831 - 7478890
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||| ||| ||||||| |||||| | ||||| ||||||||||||| |||| |
|
|
| T |
7478831 |
tctctcatactcacattattttttaccttatctctctattgctatggtttccgtgccaat |
7478890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 16327178 - 16327123
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggttt |
56 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | |||| || |||||| |
|
|
| T |
16327178 |
actttctctctcatactcacattactttttactttatctctctattattttggttt |
16327123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 7473052 - 7473014
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatct |
39 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
7473052 |
actttctctctcatactcacattactttttactttatct |
7473014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 16613679 - 16613717
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatct |
39 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
16613679 |
actttttctctcatactcacattattttttactttatct |
16613717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 42569755 - 42569709
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattg |
47 |
Q |
| |
|
||||| ||||||||| |||| |||||||||||||||||| ||||||| |
|
|
| T |
42569755 |
actttctctctcatattcacattactttttactttatctctttattg |
42569709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 36885513 - 36885449
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| ||||||| | || ||| ||||||||| |
|
|
| T |
36885513 |
actttctctctcatactcacatta-tttttactttatctctttattgctttgattttcgtgtcaat |
36885449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 41701214 - 41701255
Alignment:
| Q |
8 |
ctctcatactcacgttactttttactttatctatttattgtt |
49 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||| ||||||| |
|
|
| T |
41701214 |
ctctcatactcacattaatttttactttatctatctattgtt |
41701255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 12898956 - 12898900
Alignment:
| Q |
1 |
actttttctctcatactcacgtta-ctttttactttatctatttattgttatggttt |
56 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||| | ||||| | |||||| |
|
|
| T |
12898956 |
actttttctctcatactcacattatctttttactttatctctctattgctttggttt |
12898900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 56
Target Start/End: Original strand, 36568006 - 36568058
Alignment:
| Q |
4 |
ttttctctcatactcacgttactttttactttatctatttattgttatggttt |
56 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| | ||||| | |||||| |
|
|
| T |
36568006 |
ttttctctcatactcacattattttttactttatctctctattgctttggttt |
36568058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 41159915 - 41159855
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
41159915 |
actttctctctcatactcacattattttttactttatctctctattgctttggttttcgtg |
41159855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 25)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 8267846 - 8267781
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
8267846 |
actttctctctcatactcacattattttttactttatctctccattgttatggtttccgtgtcaat |
8267781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 21064252 - 21064187
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
21064252 |
actttctctctcatactcacattactttttactttatctccctattgttatgatttccgtgtcaat |
21064187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 4430962 - 4430897
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||||||||| | | |||||||||||||| | ||||| |||||||| ||||||||| |
|
|
| T |
4430962 |
actttttctctcatactcacatcattttttactttatctctctattgctatggttttcgtgtcaat |
4430897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 35099031 - 35098966
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| ||| |||||||||||||| |
|
|
| T |
35099031 |
actttctctctcatactcacattattttttactttatctctctattgctatagtttccgtgtcaat |
35098966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 62
Target Start/End: Original strand, 32912089 - 32912144
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtgt |
62 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||| ||||||| |||||| ||||| |
|
|
| T |
32912089 |
tctctcatactcacattactttttactttatttatctattgttttggttttcgtgt |
32912144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 3 - 66
Target Start/End: Original strand, 33620655 - 33620718
Alignment:
| Q |
3 |
tttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||||||||||||| | ||| |||||||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
33620655 |
tttttctctcatacttatattattttttactttatctctctattgctatggtttccgtgtcaat |
33620718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 61
Target Start/End: Complemental strand, 43214076 - 43214025
Alignment:
| Q |
10 |
ctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||| |||||| |||| |
|
|
| T |
43214076 |
ctcatactcacattactttttactttatctctttattgttttggttttcgtg |
43214025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 42267390 - 42267456
Alignment:
| Q |
1 |
actttttctctcatactcacgttac-tttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
42267390 |
actttttctctcatacacacattatatttttactttatctctctattgttatgatttccgtgtcaat |
42267456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 5042293 - 5042358
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | |||| ||||||||||||| |||| |
|
|
| T |
5042293 |
actttatctctcatactcacattattttttactttatctctctattactatggtttccgtgccaat |
5042358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 6931085 - 6931020
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||| |||||||||| ||| |||||||||||||| | ||||| |||| ||||||||||||| |
|
|
| T |
6931085 |
actttatctttcatactcacattattttttactttatctctctattgctatgatttccgtgtcaat |
6931020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 15267829 - 15267894
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||||||||| ||| ||| |||||||||||||| | |||||||||||||| ||||||||| |
|
|
| T |
15267829 |
actttctctctcatattcatattattttttactttatctctctattgttatggttttcgtgtcaat |
15267894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 18842347 - 18842282
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| |||||||| |||| |||| |
|
|
| T |
18842347 |
actttctctctcatactcacattattttttactttatctctctattgctatggttttcgtgccaat |
18842282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 19481208 - 19481155
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggt |
54 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||||| |||| |
|
|
| T |
19481208 |
actttctctctcatactcacattactttttactttatctctctattgttttggt |
19481155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 37700505 - 37700570
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| ||||||| |||||| | ||||| ||||||||||||| |||| |
|
|
| T |
37700505 |
actttctctctcatactcacattattttttaccttatctctctattgctatggtttccgtgccaat |
37700570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 189729 - 189669
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
189729 |
actttctctctcatactcacattactttttactttatctctctattgctttggttttcgtg |
189669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 1839371 - 1839311
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||||| |||||| |||| |
|
|
| T |
1839371 |
actttctctctcatactcacattattttttactttatctttctattgttttggttttcgtg |
1839311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 6517757 - 6517817
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
6517757 |
actttctctctcatactcacattactttttactttatctctctattgctttggttttcgtg |
6517817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 9581624 - 9581684
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| ||| |||||||||| ||| |||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
9581624 |
actttctctttcatactcacattattttttactttatctctctattgttttggtttccgtg |
9581684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 43441783 - 43441843
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
43441783 |
actttctctctcatactcacattactttttactttatctctctattgctttggttttcgtg |
43441843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 3 - 66
Target Start/End: Complemental strand, 5821636 - 5821573
Alignment:
| Q |
3 |
tttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||||||||||||| || ||| |||||||||||||| | ||| | ||||||||||||| |||| |
|
|
| T |
5821636 |
tttttctctcatacttacattattttttactttatctctctatagctatggtttccgtgccaat |
5821573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 21136308 - 21136363
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggttt |
56 |
Q |
| |
|
||||| ||| |||||||||||||| |||||||||||||| | ||||||| |||||| |
|
|
| T |
21136308 |
actttctctttcatactcacgttattttttactttatctctctattgttttggttt |
21136363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 20770176 - 20770241
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| | || ||| ||||||||| |
|
|
| T |
20770176 |
actttctctctcatactcacattattttttactttatctctctattgctttgattttcgtgtcaat |
20770241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 6446544 - 6446508
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttat |
37 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
6446544 |
actttctctctcatactcacattactttttactttat |
6446508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 39
Target Start/End: Complemental strand, 8675453 - 8675421
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatct |
39 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
8675453 |
tctctcatactcacattactttttactttatct |
8675421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 9226346 - 9226405
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||||| || |||||||| |
|
|
| T |
9226346 |
actttctctctcatactcacatta-tttttactttatctctctattgttttgatttccgtg |
9226405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 39)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 14451438 - 14451503
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | |||||||||||||| ||||||||| |
|
|
| T |
14451438 |
actttctctctcatactcacattagtttttactttatctctctattgttatggttttcgtgtcaat |
14451503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 21260343 - 21260408
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| |||||||| | ||||||||||||||||||| |||| |
|
|
| T |
21260343 |
actttttctctcatactcacattatttttttctttatctctctattgttatggtttccgtgccaat |
21260408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 41486169 - 41486104
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
41486169 |
actttctctctcatactcacattactttttactttatctctctattgctatggtttccgtgccaat |
41486104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 624338 - 624273
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| |||||||| |||| |||| |
|
|
| T |
624338 |
actttctctctcatactcacattactttttactttatctctctattgctatggttttcgtgccaat |
624273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 6141804 - 6141739
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||||| |||||||||||| ||||||| |||| |||||||| |||| |
|
|
| T |
6141804 |
actttctctctcatactcacattactctttactttatctctttattgctatgatttccgtgccaat |
6141739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 64
Target Start/End: Complemental strand, 26206997 - 26206940
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtca |
64 |
Q |
| |
|
||||||||| |||| |||||||||||||||||| | ||||||||||||||| |||||| |
|
|
| T |
26206997 |
tctctcatattcacattactttttactttatctctctattgttatggtttctgtgtca |
26206940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 22819694 - 22819740
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattg |
47 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
22819694 |
actttctctctcatactcacattactttttactttatctctttattg |
22819740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 36111422 - 36111356
Alignment:
| Q |
1 |
actttttctctcatactcacgttacttttt-actttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||||||||| ||||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
36111422 |
actttatctctcatactcacattacttttttactttatctctctattgctatggtttccgtgccaat |
36111356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 47965784 - 47965822
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatct |
39 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47965784 |
actttttctctcatactcacattactttttactttatct |
47965822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 6494919 - 6494854
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||||||||| ||| ||| |||||||||||| | | |||||||||||||||||||||||| |
|
|
| T |
6494919 |
actttctctctcatattcatattattttttactttatttctctattgttatggtttccgtgtcaat |
6494854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 30079891 - 30079956
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| ||| ||||||||| |||| |
|
|
| T |
30079891 |
actttctctctcatactcacattattttttactttatctctctattgctatagtttccgtgccaat |
30079956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 31076099 - 31076164
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| | | |||||||||||||| | |||| |||||||||||||||||| |
|
|
| T |
31076099 |
actttctctctcatactcacatcattttttactttatctctctattactatggtttccgtgtcaat |
31076164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 31657691 - 31657752
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgt |
62 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| | |||||| ||||| |
|
|
| T |
31657691 |
actttctctctcatactcacattactttttactttatctctctattgctttggttttcgtgt |
31657752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 51194314 - 51194379
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||| |||||||||| | |||||||||||||||| | |||||||||||||| |||| |||| |
|
|
| T |
51194314 |
actttctctttcatactcacatcactttttactttatctctctattgttatggttttcgtgccaat |
51194379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 13 - 66
Target Start/End: Original strand, 51746277 - 51746330
Alignment:
| Q |
13 |
atactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||| ||| |||||||||||||| | ||||||||||||||||||| |||| |
|
|
| T |
51746277 |
atactcacattattttttactttatctctctattgttatggtttccgtgccaat |
51746330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 14010144 - 14010084
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| | |||| || |||||| |||| |
|
|
| T |
14010144 |
actttttctctcatactcatattactttttactttatctctctattattttggttttcgtg |
14010084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 28657467 - 28657407
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| | ||||||||||| |
|
|
| T |
28657467 |
actttctctctcatactcacattattttttactttatctctctattgctttggtttccgtg |
28657407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 39345006 - 39344946
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
39345006 |
actttctctctcatactcacattactttttactttatctctctattgctttggttttcgtg |
39344946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 43769756 - 43769804
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgtt |
49 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| ||||||||| |
|
|
| T |
43769756 |
actttctctctcatactcacattattttttactttatctctttattgtt |
43769804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 66
Target Start/End: Original strand, 21172331 - 21172390
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||||| |||||| |||||||||||||| ||||||||| |||||| ||| ||||| |
|
|
| T |
21172331 |
tctcttatacttacgttattttttactttatctctttattgttttggttttcgtatcaat |
21172390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 25318085 - 25318027
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||||||||||| ||| |||||||||||||| ||||||| | |||||||||||||||| |
|
|
| T |
25318085 |
tctctcatactcatattattttttactttatctctttattgct-tggtttccgtgtcaat |
25318027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 30170046 - 30169991
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggttt |
56 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| |||||||| |
|
|
| T |
30170046 |
actttctctctcatactcacattattttttactttatctctctattgctatggttt |
30169991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 3 - 66
Target Start/End: Complemental strand, 53152345 - 53152282
Alignment:
| Q |
3 |
tttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||||||||||| ||| ||| |||||||||||||| | ||||||||||||||| ||| |||| |
|
|
| T |
53152345 |
tttttctctcatattcatattattttttactttatctctatattgttatggtttctgtgccaat |
53152282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 17683269 - 17683323
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtt |
55 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||| | ||||||| ||||| |
|
|
| T |
17683269 |
actttctctcttatactcacattactttttactttatctctctattgttttggtt |
17683323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 33899341 - 33899287
Alignment:
| Q |
12 |
catactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||||||| ||| ||||| |||||||| | ||||||||||||||||||| |||| |
|
|
| T |
33899341 |
catactcacattatttttttctttatctctctattgttatggtttccgtgccaat |
33899287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 38338948 - 38338910
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatct |
39 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
38338948 |
actttctctctcatactcacattactttttactttatct |
38338910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 42959316 - 42959382
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttt-tactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||||| |||||||| ||| |||| |||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
42959316 |
actttatctcttatactcacattatttttttactttatctctctattgctatggtttccgtgtcaat |
42959382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 46406000 - 46405962
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatct |
39 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
46406000 |
actttttctctcatactcacattaatttttactttatct |
46405962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 52846253 - 52846215
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatct |
39 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
52846253 |
actttctctctcatactcacattactttttactttatct |
52846215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 5932183 - 5932119
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| ||||| |||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
5932183 |
actttctctctcatactcacattatttttt-ctttatctttctattgctatggtttccgtgccaat |
5932119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 12112672 - 12112737
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||||||||| ||| ||| |||||||||||||| | ||||| |||| ||||||||||||| |
|
|
| T |
12112672 |
actttctctctcatattcatattattttttactttatctctctattgctatgatttccgtgtcaat |
12112737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 28458403 - 28458338
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| | || ||| ||||||||| |
|
|
| T |
28458403 |
actttctctctcatactcacattattttttactttatctctctattgctttgattttcgtgtcaat |
28458338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 37066033 - 37066098
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||||||| |||||||||| ||| |||||||||||||| | |||| |||| |||||||| |||| |
|
|
| T |
37066033 |
actttttctttcatactcacattattttttactttatctctccattgctatgatttccgtgccaat |
37066098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 17475947 - 17475987
Alignment:
| Q |
26 |
tttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
17475947 |
tttttactttatctctctattgctatggtttccgtgtcaat |
17475987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 17683392 - 17683440
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgtt |
49 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||| | ||||||| |
|
|
| T |
17683392 |
actttatctctcatactcatattactttttactttatctctctattgtt |
17683440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 21617228 - 21617276
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgtt |
49 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||||| |
|
|
| T |
21617228 |
actttctctctcatactcacattattttttactttatctctctattgtt |
21617276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 39
Target Start/End: Original strand, 26718419 - 26718451
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatct |
39 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
26718419 |
tctctcatactcacattactttttactttatct |
26718451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 39
Target Start/End: Original strand, 26731047 - 26731079
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatct |
39 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
26731047 |
tctctcatactcacattactttttactttatct |
26731079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 33860692 - 33860751
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| | | |||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
33860692 |
actttctctctcatactcacatca-tttttactttatctctctattgttttggtttccgtg |
33860751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 40)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 21340567 - 21340632
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||| |||||||||| |||||||||||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
21340567 |
actttctctttcatactcacattactttttactttatctctctattgctatggtttccgtgtcaat |
21340632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 36673757 - 36673692
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||||||||||||| |||| |||||||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
36673757 |
actttctctctcatactcatgttattttttactttatctctctattgctatggtttccgtgtcaat |
36673692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 46082147 - 46082082
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||| ||||||||| |||||||||||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
46082147 |
actttctctcgcatactcacattactttttactttatctctctattgctatggtttccgtgtcaat |
46082082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 47214253 - 47214318
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||||||||||||||||| |||| |
|
|
| T |
47214253 |
actttctctctcatactcacattattttttactttatctctctattgttatggtttccgtgccaat |
47214318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 51191833 - 51191898
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||| | |||||||||| |||||||| |||| |
|
|
| T |
51191833 |
actttttctctcatactcacattacattttactttatctctctattgttatgctttccgtgccaat |
51191898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 7 - 66
Target Start/End: Original strand, 26837503 - 26837562
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||| ||| ||||| |||||||| |
|
|
| T |
26837503 |
tctctcatactcacgttactttttactttatctctctattgctatagtttctgtgtcaat |
26837562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 3603156 - 3603221
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| |||||||||| ||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
3603156 |
actttctctctcatactcacattactttttagtttatctctctattgctatggtttccgtgccaat |
3603221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 8411744 - 8411679
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||||| ||||||||||| |||| |
|
|
| T |
8411744 |
actttctctctcatactcacattattttttactttatctctctattgttttggtttccgtgccaat |
8411679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 16986983 - 16987048
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| |||| ||||||||||||| |
|
|
| T |
16986983 |
actttctctctcatactcacattattttttactttatctttctattgctatgatttccgtgtcaat |
16987048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 21486343 - 21486278
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
21486343 |
actttctctctcatactcacattattttttactttatctctctattgctatggtttccgtgccaat |
21486278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 36779295 - 36779230
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||||| ||||||||| || |||||||||||||||||| | ||||| |||| ||||||||||||| |
|
|
| T |
36779295 |
actttttttctcatacttacattactttttactttatctctctattgctatgatttccgtgtcaat |
36779230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 902683 - 902743
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| |||| |||||||| |
|
|
| T |
902683 |
actttctctctcatactcacattactttttactttatctctctattgctatgatttccgtg |
902743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 32915098 - 32915038
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||||| |||||| |||| |
|
|
| T |
32915098 |
actttctctctcatactcacattactttttactttatctctctattgttttggttttcgtg |
32915038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 34254377 - 34254317
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| ||||||| | |||||| |||| |
|
|
| T |
34254377 |
actttatctctcatactcacattactttttactttatctctttattgctttggttttcgtg |
34254317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 9 - 61
Target Start/End: Complemental strand, 52714919 - 52714867
Alignment:
| Q |
9 |
tctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||| |||||| |||| |
|
|
| T |
52714919 |
tctcatactcacgttactttttactttatctctctattgttttggttttcgtg |
52714867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 36577438 - 36577392
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattg |
47 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
36577438 |
actttctctctcatactcacattactttttactttatctctttattg |
36577392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 9 - 66
Target Start/End: Original strand, 756909 - 756966
Alignment:
| Q |
9 |
tctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
756909 |
tctcatactcacattattttttactttatctctctattgctatggtttccgtgccaat |
756966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 20565144 - 20565079
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||||| |||||||||||| | |||| ||||||||||||| |||| |
|
|
| T |
20565144 |
actttctctctcatactcacattactctttactttatctctctattactatggtttccgtggcaat |
20565079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 13 - 66
Target Start/End: Complemental strand, 26585893 - 26585840
Alignment:
| Q |
13 |
atactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||| ||| ||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
26585893 |
atactcacattattttttactttatcgctctattgttatggtttccgtgtcaat |
26585840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 33024597 - 33024532
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| ||||| |||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
33024597 |
actttctctctcatactcacattatttttttctttatctctctattgctatggtttccgtgccaat |
33024532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 44632573 - 44632638
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| ||| | |||||||||||| |
|
|
| T |
44632573 |
actttctctctcatactcacattattttttactttatctctctattgctatagattccgtgtcaat |
44632638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 51286393 - 51286328
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||||| ||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
51286393 |
actttctctctcatactcacattattttttattttatctctctattgctatggtttccgtgccaat |
51286328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 13489707 - 13489767
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
13489707 |
actttctctctcatactcacattactttttactttatctctctattgctttggttttcgtg |
13489767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 15705088 - 15705028
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| | ||||||| |||||| |||| |
|
|
| T |
15705088 |
actttctctctcatactcacattactttttactttatcattctattgttttggttttcgtg |
15705028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 19969588 - 19969528
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
19969588 |
actttctctctcatactcacattactttttactttatctctctattgctttggttttcgtg |
19969528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 50328167 - 50328107
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
50328167 |
actttctctttcatactcacgttactttttactttatctctctattgctttggttttcgtg |
50328107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 50781596 - 50781536
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
50781596 |
actttctctctcatactcacattactttttactttatctctctattgctttggttttcgtg |
50781536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 3024770 - 3024711
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||||||||||| ||| |||||||||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
3024770 |
tctctcatactcatattattttttactttatctctctattgctatggtttccgtgccaat |
3024711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 29586044 - 29586095
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttcc |
58 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| | |||| ||||||||||| |
|
|
| T |
29586044 |
tctctcatactcacattattttttactttatctctctattattatggtttcc |
29586095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 10890072 - 10890034
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatct |
39 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
10890072 |
actttctctctcatactcacattactttttactttatct |
10890034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 61
Target Start/End: Complemental strand, 40316964 - 40316910
Alignment:
| Q |
7 |
tctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
40316964 |
tctctcatactcacattactttttactttatctctctattgctttggttttcgtg |
40316910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 1790553 - 1790618
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||| | ||||| || |||||||||| |||| |
|
|
| T |
1790553 |
actttctctctcatactcaaattactttttactttatccctctattgataaggtttccgtgccaat |
1790618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 1852977 - 1852912
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| ||||| |||| ||| | ||||| ||||||||||||| |||| |
|
|
| T |
1852977 |
actttctctctcatactcacattatttttttctttgtctctctattgctatggtttccgtgccaat |
1852912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 66
Target Start/End: Complemental strand, 4514472 - 4514415
Alignment:
| Q |
9 |
tctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||||| |||| ||| |||||||||||||| | ||||| ||||||||||||| |||| |
|
|
| T |
4514472 |
tctcatattcacattattttttactttatctttctattgctatggtttccgtgccaat |
4514415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 32319335 - 32319270
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||||| ||| |||| |||| |||| | |||| |||||||||||||||||| |
|
|
| T |
32319335 |
actttctctctcatactcacattatttttcacttcatctctctattactatggtttccgtgtcaat |
32319270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 38303714 - 38303649
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| |||||||||||| | ||| |||||||||||||| | ||||| |||||||||||| |||| |
|
|
| T |
38303714 |
actttctctctcatactcgcattattttttactttatctctctattgccatggtttccgtgccaat |
38303649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 9008270 - 9008326
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttc |
57 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| |||||||| |
|
|
| T |
9008270 |
actttctctctcatactcacattattttttactttatctctctattgccatggtttc |
9008326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 29147899 - 29147840
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| ||||| |||||||||| | |||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
29147899 |
actttctctcttatactcacgtca-tttttactttatctctctattgttttggtttccgtg |
29147840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 56
Target Start/End: Complemental strand, 33125348 - 33125296
Alignment:
| Q |
4 |
ttttctctcatactcacgttactttttactttatctatttattgttatggttt |
56 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||| | ||||| | |||||| |
|
|
| T |
33125348 |
ttttctttcatactcacattactttttactttatctttctattgctttggttt |
33125296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 52362527 - 52362587
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
52362527 |
actttctctctcatactcacattattttttactttatctctctattgctttggttttcgtg |
52362587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0687 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0687
Description:
Target: scaffold0687; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 2242 - 2307
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
||||| ||||||||| |||| ||| |||||||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
2242 |
actttatctctcatagtcacattattttttactttatctctctattgctatggtttccgtgtcaat |
2307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 9 - 66
Target Start/End: Complemental strand, 134321 - 134264
Alignment:
| Q |
9 |
tctcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| ||||||||| |||||| ||||||||| |
|
|
| T |
134321 |
tctcatactcacattattttttactttatctctttattgttttggttttcgtgtcaat |
134264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0471 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0471
Description:
Target: scaffold0471; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 66
Target Start/End: Original strand, 62 - 117
Alignment:
| Q |
11 |
tcatactcacgttactttttactttatctatttattgttatggtttccgtgtcaat |
66 |
Q |
| |
|
|||||||||| |||||||||||||||||| | |||||||||||||| |||| |||| |
|
|
| T |
62 |
tcatactcacattactttttactttatctctctattgttatggttttcgtgccaat |
117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0136 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0136
Description:
Target: scaffold0136; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 61
Target Start/End: Original strand, 38478 - 38530
Alignment:
| Q |
9 |
tctcatactcacgttactttttactttatctatttattgttatggtttccgtg |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||| | |||||| |||| |
|
|
| T |
38478 |
tctcatactcacgttactttttactttatctctctattgctttggttttcgtg |
38530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0532 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0532
Description:
Target: scaffold0532; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 11009 - 11057
Alignment:
| Q |
1 |
actttttctctcatactcacgttactttttactttatctatttattgtt |
49 |
Q |
| |
|
||||| |||||||||||||| ||| |||||||||||||| | ||||||| |
|
|
| T |
11009 |
actttctctctcatactcacattattttttactttatctctctattgtt |
11057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University