View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14504_high_39 (Length: 274)
Name: NF14504_high_39
Description: NF14504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14504_high_39 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 18 - 268
Target Start/End: Original strand, 42769354 - 42769604
Alignment:
| Q |
18 |
ctaaggtggagctatgagggtgtaaagtccatgctattgaggcttgttgtgtaggaagattcatgcatttttgaaaggttttagtggaagtttctgttgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42769354 |
ctaaggtggagctatgagggtgtaaagtccatgctattgaggcttgttgtgtaggaagattcatgcatttttgaaaggttttagtggaagtttctgttgt |
42769453 |
T |
|
| Q |
118 |
gcagtgagatgagaaaacaatgtgaggaaggaaacatagggaaagtgagaggaggaagagataaacatggaacatggtgatagatgtttgtagtaatgga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42769454 |
gcagtgagatgagaaaacaatgtgaggaaggaaacatagggaaagtgagaggaggaagagataaacatggaacatggtgatagatgtttgtagtaatgga |
42769553 |
T |
|
| Q |
218 |
tgtttgttactagctagcttttgtaaaagatttgtgttttctgatgatgtc |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42769554 |
tgtttgttactagctagcttttgtaaaagatttgtgttttctaatgatgtc |
42769604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 18 - 153
Target Start/End: Complemental strand, 2452177 - 2452042
Alignment:
| Q |
18 |
ctaaggtggagctatgagggtgtaaagtccatgctattgaggcttgttgtgtaggaagattcatgcatttttgaaaggttttagtggaagtttctgttgt |
117 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||| ||||||||||| || ||||||||||| |||||||| ||||||||||| || |||||| || |
|
|
| T |
2452177 |
ctaaggtggagttatgagggtagaaagtccatgctatagaggcttgttgggtgggaagattcatacatttttggaaggttttagtagaggtttctacagt |
2452078 |
T |
|
| Q |
118 |
gcagtgagatgagaaaacaatgtgaggaaggaaaca |
153 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
2452077 |
gcagtgagatgaaaaaccaatgtgaggaaggaaaca |
2452042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University