View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14504_high_52 (Length: 230)

Name: NF14504_high_52
Description: NF14504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14504_high_52
NF14504_high_52
[»] chr7 (1 HSPs)
chr7 (7-143)||(24067234-24067372)


Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 7 - 143
Target Start/End: Original strand, 24067234 - 24067372
Alignment:
7 gtaacgagtggatgagaagttatggtccaagaggtatttgtcaactaaaaaagcaacttgttcagggatgacttttgccgccatt--aacaaagaatgaa 104  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||    
24067234 gtaacgagtggatgagaagttatggtccaagaggtatttgtcaactaaaaaagcaacttgttcagggatgacttttgccgccattagaacaaagaatgaa 24067333  T
105 gttatagacctgtgagatcaaaaacaaatagaaaacttt 143  Q
    | |||||||||||||||||||||||||||||||||||||    
24067334 gatatagacctgtgagatcaaaaacaaatagaaaacttt 24067372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University