View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14504_high_55 (Length: 226)
Name: NF14504_high_55
Description: NF14504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14504_high_55 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 7 - 226
Target Start/End: Complemental strand, 38455192 - 38454973
Alignment:
| Q |
7 |
gttgggatgttagcaaaagaatgtcaaacatataggccaaggccaagggcaatttgggtatgaatatcgaattattggtacaatttttgatccaagatcc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38455192 |
gttgggatgttagcaaaagaatgtcaaacatataggccaaggccaagggcaatttgggtatgaatatcgaattattggtacaatttgtgatccaagatcc |
38455093 |
T |
 |
| Q |
107 |
cttgaataatgtgctgagatagatatattgatccacatatctggcacatgtctttgccttgtgtgatacaagttcaagattcagttgtccctttccttat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38455092 |
cttgaataatgtgctgagatagatatattgatccacatatctggcacatgtctttgccttgtgtgatacaagttcaagattcagttgtccctttccttat |
38454993 |
T |
 |
| Q |
207 |
gcctcccaccatgtttggca |
226 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38454992 |
gcctcccaccatgtttggca |
38454973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University