View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14504_low_35 (Length: 314)
Name: NF14504_low_35
Description: NF14504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14504_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 3 - 299
Target Start/End: Original strand, 34432556 - 34432853
Alignment:
| Q |
3 |
gatgatcatcacttgcagaagagaaacatgcaggaattccaattgagtcttgcattgttgttgatgatgagtttattggagagnnnnnnnngtgagaaga |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34432556 |
gatgatcatcacttgcagaagagaaacatgcaggaattccaattgagtcttgcattgttgttgatgatgagtttattggagagaaaaaaaagtgagaaga |
34432655 |
T |
 |
| Q |
103 |
tgaaaaggatgtgaacagattggagtgagagggaatttaacatgaatttaaggagtaggagatgagagaagagannnnnnnnatttaatagataaataaa |
202 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
34432656 |
tgaaaaggatatgaacagattggagtgagagggaatttaacatgaatttaaggagtaggagatgagagaagaaattttatttatttaatagataaataaa |
34432755 |
T |
 |
| Q |
203 |
tttaggtgagttgggctcattagagtccggacatgtctcaaagctc-aaaaaacgtgttgacaaaaatacttgtagattacaccaacaaagtcttcat |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34432756 |
tttaggtgagttgggctcattagagtccggacatgtctcaaagctcaaaaaaacgtgttgacaaaaatacttgtagattacaccaacaaagtcttcat |
34432853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University