View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14504_low_40 (Length: 295)
Name: NF14504_low_40
Description: NF14504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14504_low_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 18 - 279
Target Start/End: Original strand, 46301247 - 46301507
Alignment:
| Q |
18 |
cacattgtaacaaacaccaacctttgcaacagctacatttttgttttctcatacttactctttgtggtttttgtctttctttgtaacaatggaagacgaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46301247 |
cacattgtaacaaacaccaacctttgcaacagctacattttagttttctcatacttactctttgtggtttttgtctttctttgtaacaatggaagacgaa |
46301346 |
T |
|
| Q |
118 |
ggcttaatgcctttgttctatgctaggcagaaaaaatggtggttccatgcgacaacaatgtttctcatgctgttgcttctttctccatttgcattttcac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46301347 |
ggcttaatgcctttgttctatgctaggcagaaaaaatggtggttccatgcgacaacaatgtttctcatgctgttgcttctttctccatttgcattttcac |
46301446 |
T |
|
| Q |
218 |
ttcaggaagaaggtttgtgcttttgtaacttttattgtcatgtggagtaacctctttagttc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
46301447 |
ttcaggaagaaggtttgtgcttttgtaactattattgtcatgtggagtaacct-tttagttc |
46301507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 46301204 - 46301248
Alignment:
| Q |
1 |
accatttctctctcccccacattgtaacaaacaccaacctttgca |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46301204 |
accatttctctctcccccacattgtaacaaacaccaacctttgca |
46301248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University