View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14504_low_48 (Length: 268)
Name: NF14504_low_48
Description: NF14504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14504_low_48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 16 - 248
Target Start/End: Original strand, 19159073 - 19159305
Alignment:
| Q |
16 |
acctgtgtaccttcctttatttcatgtgatcagcctcaatggtatccacagggtgcacattctctttcccgtaggaacgataattggaacgcgtatgatt |
115 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19159073 |
acctgtgtaccttcctttatttcacgtgatcaacctcaatggtatccacatggtgcatattctctttcccgtaggaacgataattggaacgcgtatgatt |
19159172 |
T |
 |
| Q |
116 |
atgcacctgataaccaccatcgcgtaggaccatggtatctctcgatcagactgcccttgcatagggaaattcatcgaaactgtgctgatcaaagaagttg |
215 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19159173 |
ttgcacctgataaccaccatcgcgcaagaccatggtatctctcgatcgtcctgcccttgcatagggaaattcatcgaaattgtgctgatcaaagaagtta |
19159272 |
T |
 |
| Q |
216 |
ttcttatcggaataatattgctgccaatctgga |
248 |
Q |
| |
|
| ||||||||||||||| ||||||||||||||| |
|
|
| T |
19159273 |
tccttatcggaataatactgctgccaatctgga |
19159305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University