View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14504_low_55 (Length: 240)
Name: NF14504_low_55
Description: NF14504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14504_low_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 228
Target Start/End: Original strand, 48684378 - 48684587
Alignment:
| Q |
19 |
agttcttcacaaccatattgtgtcgtgatttcataaagatactctcttttagttccaaggtgttcagtggccttgacatcccatattggatgcacaacaa |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48684378 |
agttcttcacaaccatattgtgtggtgatttcataaagatactctcttttagttccaaggtgttcagtggccttgacatcccatattggatgcacaacaa |
48684477 |
T |
 |
| Q |
119 |
ggacaaagaaagaaaaataaggaagaagtttaagtattggtgttttccaaccatgactattgtagtatttaggtttggagatatgtatgattttggttat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48684478 |
ggacaaagaaagaaaaataaggaagaagttaaagtattggtgttttccaaccatgactattgtagtatttaggtttggagatatgtatgattttggttat |
48684577 |
T |
 |
| Q |
219 |
tgagaataat |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
48684578 |
tgagaataat |
48684587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University