View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14504_low_60 (Length: 233)
Name: NF14504_low_60
Description: NF14504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14504_low_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 38454946 - 38454718
Alignment:
| Q |
1 |
tgcgatttctttgtcccatttttatgcccacaacaacgttcaggaaattatggagacgctgtagctggctggatcagcaaaatcttcaaggcacacaann |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38454946 |
tgcgatttctttgtcccatttttatgcccacaacaacgttcaggaaattatggagacgctgtagctggctggatcagcaaaatcttcaaggcacacaatt |
38454847 |
T |
 |
| Q |
101 |
nnnnnnnnnnnnnnnnagttacactgtcatgactcgtcactcgtgagtattgttctttaaacaaaacatcacatgcagattagttattcaatactaacat |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
38454846 |
ttttattcttttttatagttacactgtcatgactcgtgactcgtgagtattgttctttaaacaaaacatcacatgtaaattagttattcaatactaacat |
38454747 |
T |
 |
| Q |
201 |
gcaatggaaatatttttccacgtttgaat |
229 |
Q |
| |
|
||||||||||||||||||||| ||||||| |
|
|
| T |
38454746 |
gcaatggaaatatttttccacctttgaat |
38454718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University