View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14504_low_61 (Length: 230)
Name: NF14504_low_61
Description: NF14504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14504_low_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 7 - 143
Target Start/End: Original strand, 24067234 - 24067372
Alignment:
| Q |
7 |
gtaacgagtggatgagaagttatggtccaagaggtatttgtcaactaaaaaagcaacttgttcagggatgacttttgccgccatt--aacaaagaatgaa |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24067234 |
gtaacgagtggatgagaagttatggtccaagaggtatttgtcaactaaaaaagcaacttgttcagggatgacttttgccgccattagaacaaagaatgaa |
24067333 |
T |
 |
| Q |
105 |
gttatagacctgtgagatcaaaaacaaatagaaaacttt |
143 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24067334 |
gatatagacctgtgagatcaaaaacaaatagaaaacttt |
24067372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University