View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14504_low_7 (Length: 483)
Name: NF14504_low_7
Description: NF14504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14504_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 14 - 419
Target Start/End: Complemental strand, 30737616 - 30737218
Alignment:
| Q |
14 |
cacagacatgacttattatgcttgggtcaaggcataatttaacatg-atgtatataaaacatctatgatgcttcttttgtattggaggcttccaatagat |
112 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30737616 |
cacagacatgacttattatgcttgagtcaaggcataagttaacatggatgtatataaaacatctatgatacttcttttgtattggaggcttccaatagat |
30737517 |
T |
 |
| Q |
113 |
tttgtgtccttgcttcaatgatgaattcattgcatagtgtttacatcgagagatgtaagttggctcggatgtatttaaaacattcgagaccaggcatttt |
212 |
Q |
| |
|
|| ||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30737516 |
ttcgtgtccttgcttcaaggatgaattcattccatagtgtttacat--------gtaagttggctcggatgtatttaaaacattcgagaccaggcatttt |
30737425 |
T |
 |
| Q |
213 |
tctacaaatgctcgacttggtttttactgaattaaaccaatgatggggtagaggaaccttgatcttcccttcattattgaattagaggaacaattgttcc |
312 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30737424 |
tctacaaatgctcgacttggtttttcctgaattaaaccaatgatggggtagaggaaccttgatcttcccttcattattgaattagaggaacaattgttcc |
30737325 |
T |
 |
| Q |
313 |
atcagaggatcgattacatgactcagatttcttagccattgtttctacttgatgccattccttggactgaatggatgcacttgccgttgtggggaacgca |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
30737324 |
atcagaggatcgattacatgactcagatttcttagccattgtttctacttgatgccattccttggactgaattgatgcacctgccgttgtggggaacgca |
30737225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University