View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14505_high_5 (Length: 297)
Name: NF14505_high_5
Description: NF14505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14505_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 94 - 282
Target Start/End: Complemental strand, 6549641 - 6549453
Alignment:
| Q |
94 |
taaggagtaaggcaagatgagaagttgcagaaaggaaggatctttggataatgtgtgccgtacaagatcttcaatccaaagctttttcctgcaatgcacg |
193 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6549641 |
taaggaataaggcaagatgagaagttgcagaaaggaaggatctttggataatgtgtgccgtacaagatcttcaatccaaagctttttcctgcaatgcacg |
6549542 |
T |
 |
| Q |
194 |
ttaacctcttaatcaagttatttaacttcttaactcatctttaaaattcagaaactgggtttgttaaggtgttgccggtgcccgaactg |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
6549541 |
ttaacctcttaatcaagttatttaacttcttaactcatctttaaaattcagaaactgggtttgttaaggagttgccggtgccggaactg |
6549453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University