View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14505_high_8 (Length: 224)
Name: NF14505_high_8
Description: NF14505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14505_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 7098659 - 7098859
Alignment:
| Q |
1 |
attctattttccttactaaaaatgaaccattaacgtagttctggaaaatttgtatgcagaatctgtgcgggatgcaatgctgagattggccatggaagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7098659 |
attctattttccttactaaaaatgaaccattaacatagttctggaaaatttgtatgcagaatctgtgcgggatgcaatgctgagattggccatggaagat |
7098758 |
T |
|
| Q |
101 |
ttttaaattgcatggaaggtgactggcatccacaatgcttcacctgtcaatgctgtcatgcatgccatctgccaatcactgattatgaggttagagtttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7098759 |
ttttaaattgcatggaaggtgactggcatccacaatgcttcac---------ctgtcatgcatgccatctgccaatcactgattatgaggttagagtttc |
7098849 |
T |
|
| Q |
201 |
tttttctgtg |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
7098850 |
tttttctgtg |
7098859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 55 - 202
Target Start/End: Original strand, 7091590 - 7091728
Alignment:
| Q |
55 |
tgcagaatctgtgcgggatgcaatgctgagattggccatggaagatttttaaattgcatggaaggtgactggcatccacaatgcttcacctgtcaatgct |
154 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| ||| | ||||||||||||||||||| |||||| |
|
|
| T |
7091590 |
tgcagaatctgtgctggatgcaatgctgagattggccatggaagatttttaagttgcatgggaggggtctggcatccacaatgcttc------caatgc- |
7091682 |
T |
|
| Q |
155 |
gtcatgcatgccatctgccaatcactgattatgaggttagagtttctt |
202 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7091683 |
--catgcttgccatctgccaatcactgattatgaggttagagtttctt |
7091728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 137
Target Start/End: Complemental strand, 33408083 - 33408001
Alignment:
| Q |
55 |
tgcagaatctgtgcgggatgcaatgctgagattggccatggaagatttttaaattgcatggaaggtgactggcatccacaatg |
137 |
Q |
| |
|
||||||||||| || |||||||||| |||||||| |||||||| ||||| | |||||||| || || ||||||||| |||| |
|
|
| T |
33408083 |
tgcagaatctgcgctggatgcaatgtcgagattgggcatggaaggtttttgagttgcatgggagctgtatggcatccagaatg |
33408001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University