View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14506_high_23 (Length: 352)
Name: NF14506_high_23
Description: NF14506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14506_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 21 - 339
Target Start/End: Original strand, 10927946 - 10928266
Alignment:
| Q |
21 |
ctcatgagctctgatttgatccgaccgcatattgccgtacatgctcttgtagccgcatgctgcagggggtttgtcgatgtggttgagacactcataaagg |
120 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10927946 |
ctcatgagctctgattttatccgaccgcatattgctgtacatgctcttgtggccgcatgctgcagggggtttgtagatgtggttgagacactcataaagg |
10928045 |
T |
 |
| Q |
121 |
tacgtgttctgcagcagcatg----attctagagattttgtaatggatactctgaactgatatatgatccagaagcatctgcaattgttctgtccctatt |
216 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||| |||| ||| | |
|
|
| T |
10928046 |
tacgtgttctgcagcagcatgcatgattatagagattttgtaacggatactctgaa--gatatatgatccagaagcatctgcatttgttttgtctctact |
10928143 |
T |
 |
| Q |
217 |
atttggcacgttaaaaagttgggtccatgatattgtcttcttcctagaggcttgggtacaactgacagattcccccaacatcccctaataatattatgaa |
316 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10928144 |
atttggcacattaaaaagttgggtccatgatattgtctttttcctagaggcttgggtacaactgacagattcccccaacatcccctaataatattatgaa |
10928243 |
T |
 |
| Q |
317 |
actagtgttaccttgagtattat |
339 |
Q |
| |
|
|||||||| |||| ||||||||| |
|
|
| T |
10928244 |
actagtgtcacctagagtattat |
10928266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University