View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14506_high_28 (Length: 296)
Name: NF14506_high_28
Description: NF14506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14506_high_28 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 16 - 296
Target Start/End: Original strand, 22042245 - 22042525
Alignment:
| Q |
16 |
aatatgatttacggtttggtagttttgtgcttctgctgtgaaagggagggaaatcatcagtggaatgaagtgtccttccaagagtcattatgaatcggct |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
22042245 |
aatatgatttacggttcggtagttttgtgcttctgctgtgaaagggagggaaatcatcagtggaatgaagtgtccttccaagagtcattatgaatcgggt |
22042344 |
T |
 |
| Q |
116 |
ttggccaacatagtttagcacaatttttctaatgccttcaaaatggtaaaaatctcttatggcagtccatcctgtagttagtaaagggagagtttctgaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22042345 |
ttggccaacatagtttagcacaatttgtctgatgccttcaaaatggtaaaaatctcttatggcagttcatcctgtagttagtaaagggagagtttctgaa |
22042444 |
T |
 |
| Q |
216 |
ttgttgaaagttacatggtgactttttccattaatatctatcagattccaaactagtttcaaattgtcgaattcttcaaga |
296 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||| |||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
22042445 |
ttgttgaaagttgcatggtgactttttccattaacatctatgagattccaaactggattcaaatcatcgaattcttcaaga |
22042525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University