View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14506_high_30 (Length: 266)
Name: NF14506_high_30
Description: NF14506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14506_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 145 - 198
Target Start/End: Original strand, 39010390 - 39010443
Alignment:
| Q |
145 |
taattagcagttagtattatatagataaatttttacttaatcaaattattgatg |
198 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39010390 |
taattaacagttagtattatatagataaatttttacttaatcaaattattgatg |
39010443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 218 - 257
Target Start/End: Original strand, 39010461 - 39010500
Alignment:
| Q |
218 |
attgcggtggttttaagttgcaagacacttcttctttaaa |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39010461 |
attgcggtggttttaagttgcaagacacttcttttttaaa |
39010500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University