View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14506_high_32 (Length: 254)
Name: NF14506_high_32
Description: NF14506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14506_high_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 31 - 238
Target Start/End: Original strand, 50102014 - 50102221
Alignment:
| Q |
31 |
ccaccagtgggattagacttggttgctgttgttgttgtaacaattaaatacattgtcgattcagatttcgatgagcttgatatgattaaagactatcaaa |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
50102014 |
ccaccagtgggattagacttggttgctgttgttgttgtaacaattaaatacattgtcgattcagatttagatgagcttgatatgattaaagaccatcaaa |
50102113 |
T |
 |
| Q |
131 |
aatatatgttttatgattgctctgtctgtagtaaatggcctgggaaaaagcactggagggtaaccattactatgttgatctaattgtttcttgggttatg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50102114 |
aatatatgttttatgattgctctgtctgtagtaaatggcctgggaaaaagcactggagggtaaccattactatgttgatctaattgtttcttgggttatg |
50102213 |
T |
 |
| Q |
231 |
tttttcat |
238 |
Q |
| |
|
|||||||| |
|
|
| T |
50102214 |
tttttcat |
50102221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 36 - 69
Target Start/End: Original strand, 26299324 - 26299357
Alignment:
| Q |
36 |
agtgggattagacttggttgctgttgttgttgta |
69 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
26299324 |
agtgggataagacttggttgctgttgttgttgta |
26299357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University