View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14506_high_33 (Length: 254)
Name: NF14506_high_33
Description: NF14506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14506_high_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 43533849 - 43534085
Alignment:
| Q |
19 |
tagacatctaaatctctgaatacaatatatgctctttgctgtatgt----------atgatattatgagtgaaatttacatgatcccatgtgggaataat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43533849 |
tagacatctaaatctctgaatacaatatatgctctttgctgtatgtcatgagatgtatcatattatgagtgaaatttacatgatcccatgtgggaataat |
43533948 |
T |
 |
| Q |
109 |
gtataggaccacggtggaaagatacttccaaattat-gatttgactttttattctattttctatgcatttgtatttcaaaatgaattagattccctaaga |
207 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43533949 |
gtataggaccatggtggaaagatacttccaaattattgatttgactttttattctattttctatgcatttgtatttcaaaatgaattagattccctaaga |
43534048 |
T |
 |
| Q |
208 |
ttttcattgatggctttgtttttgtgtatgatgatgt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43534049 |
ttttcattgatggctttgtttttgtgtatgatgatgt |
43534085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University