View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14506_high_39 (Length: 227)
Name: NF14506_high_39
Description: NF14506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14506_high_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 2 - 112
Target Start/End: Complemental strand, 49755186 - 49755076
Alignment:
| Q |
2 |
taattaattaaataaataaatgtgaagtgatcagtaattctcatttaacgaatcacacgagagccaagggaggagtaatacatgctatcgccacattctc |
101 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49755186 |
taattaaataaataaataaatgtgaagtgatcagtaattctcatttaacgaatcacacgagagccaagggaggagtaatacatgctatcgccacattctc |
49755087 |
T |
|
| Q |
102 |
atgtcatgttt |
112 |
Q |
| |
|
||||||||||| |
|
|
| T |
49755086 |
atgtcatgttt |
49755076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 141 - 200
Target Start/End: Complemental strand, 49754998 - 49754939
Alignment:
| Q |
141 |
atatgcttcttgcaatagaaacagtttggtatgtgttgaccaatagggatgaattcggta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49754998 |
atatgcttcttgcaatagaaacagtttggcatgtgttgaccaatagggatgaattcggta |
49754939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University