View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14506_high_45 (Length: 204)
Name: NF14506_high_45
Description: NF14506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14506_high_45 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 6 - 204
Target Start/End: Complemental strand, 49755593 - 49755386
Alignment:
| Q |
6 |
acgacgaagagtcatgatgttgtggaagagtggaccgagaagggagatagtggaagaagaaagtggaaattgctattccaatgagaaggaaagggactcg |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49755593 |
acgaagaagagtcatgatgttgtggaagagtggatcgagaagggagatagtggaagaagaaagtggaaattgctattccaatgagaaggaaagggactcg |
49755494 |
T |
 |
| Q |
106 |
atttagaagca---------tgtttgttctcgttcttggaagaggattatcacgatgggatgatgaatctgtggtttgatctcttgtttggtttctgtga |
196 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49755493 |
atttagaagcatgttgatgatgtttgttctcgttcttggaagaggattatcacgatgggatgatgaatctgtggtttgatctcttgtttggtttctgtga |
49755394 |
T |
 |
| Q |
197 |
attagttc |
204 |
Q |
| |
|
|||||||| |
|
|
| T |
49755393 |
attagttc |
49755386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University