View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14506_low_27 (Length: 339)
Name: NF14506_low_27
Description: NF14506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14506_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 12 - 320
Target Start/End: Complemental strand, 17108152 - 17107839
Alignment:
| Q |
12 |
atcatcattgtaagccataatgggattattgacatatttgcatagaacctttatgggaatctttttacgagctttagcattttttatcctccttatcatc |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17108152 |
atcattattgtaagccataatgggattattgacatatttgcatagaacctttatgggaatctttttacgagctttagcattttttatcctccttatcatc |
17108053 |
T |
 |
| Q |
112 |
tctataaatcttggctttcttgcactcattgatcgaatgccgaacatttttgctaacattaccaaactatggagtttttcagaa-----tcaatgtccac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17108052 |
tctataaatcttggctttcttgcactcattgatcgaatgccgaacatttttgctaacattaccaaactatggagtttttcagaatcaaatcaatgtccac |
17107953 |
T |
 |
| Q |
207 |
atagaatgagtattcagatctttcaactaacattttatcatgtaactgtccagaaagatcaatatctactagaattctagcatagtgatcaaagcttcga |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
17107952 |
atagaatgagtattcagatctttcaactaacattttatcatgtaactttccagaaagatcaacatctaccagaattctagcatggtgatcaaagcttcga |
17107853 |
T |
 |
| Q |
307 |
taaaaattagactt |
320 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
17107852 |
taaaaattagactt |
17107839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University