View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14506_low_36 (Length: 265)
Name: NF14506_low_36
Description: NF14506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14506_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 18 - 252
Target Start/End: Complemental strand, 192102 - 191880
Alignment:
| Q |
18 |
cctttgaacaaattaaagatgtttgagtcnnnnnnnntaatagacatagaatgaggttgattcccaggcatggattcacataaactaaggttgtgccact |
117 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
192102 |
cctttcaacaaattaaagatgtttgagtcaaaaaaaataatagacatagaatgaggttgattcccagg--tggattcacataaactaaggttgtgccact |
192005 |
T |
 |
| Q |
118 |
cttgatccgatattttcggtctgtacccttccttccacgtactgattaatgaatccaacttgctttaatatatacatgtgaatgtgatgtatatatcttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
192004 |
cttgatccgatattttcggtctgtacccttccttcc----actgattaatgaatccaacttgctttaatatatac------atgtgatgtatatatcttg |
191915 |
T |
 |
| Q |
218 |
atcttgtgctttaatccaacttgtatttatagtat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
191914 |
atcttgtgctttaatccaacttgtatttatagtat |
191880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University