View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14506_low_42 (Length: 246)
Name: NF14506_low_42
Description: NF14506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14506_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 9 - 234
Target Start/End: Original strand, 1330226 - 1330451
Alignment:
| Q |
9 |
aaatacctcgtcaaggataactgtcccagcaacagcaactaacctttcatgcccttgtctctggtccataactttatggcttagagcatcactttccatg |
108 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1330226 |
aaatacctcgtcaagggtaactgtcccagcaacagcaagcaaactttcatgcccttgtctctggtccataactttatggcttagagcatcactttccatg |
1330325 |
T |
 |
| Q |
109 |
ataaaatccaagttatcaacagaagatacattatcaatcatggctgctaagtgttcactatctttcagaagggcatctagataacgagttaattcaccct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1330326 |
ataaaatccaagttatcaacagaagatacattatcaatcatggctgctaagtgttcactatctttcagaagggcatctagataacgagttaattcaccct |
1330425 |
T |
 |
| Q |
209 |
gagtaacaccaaattctttaagtctg |
234 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
1330426 |
gagtaacaccaaattctttaagtctg |
1330451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University