View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14506_low_43 (Length: 241)
Name: NF14506_low_43
Description: NF14506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14506_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 10 - 228
Target Start/End: Complemental strand, 940930 - 940712
Alignment:
| Q |
10 |
atataaccagctggaaacttcaagaatccatacggattttttggattatcgggtggccttggatcctcatcttgtttaccgtctgaaaacaacgaaccat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
940930 |
atataaccagctggaaacttcaagaatccataaggattttttggattatcgggcggccttggatcctcgtcttgtttaccgtctgaaaacaacgaaccat |
940831 |
T |
|
| Q |
110 |
attcgatatttggatcttctccatcgtcaaaagggtctagccatggattgttctttttggcatttacgcgaagatttagtcttctagttgaattgtaaca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
940830 |
attcgatatttggatcttctccatcgtcaaaagggtctagccatggattgttctttttggcatttacgcgaagatttagtcttctagttgaattgtaaca |
940731 |
T |
|
| Q |
210 |
atgtgatggatggtctaat |
228 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
940730 |
atgtgatggatggtctaat |
940712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University