View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14507_high_12 (Length: 292)
Name: NF14507_high_12
Description: NF14507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14507_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 106 - 272
Target Start/End: Complemental strand, 39185598 - 39185434
Alignment:
| Q |
106 |
actattttcgtttgcatttagtcacgatcgtttctttagagaaatgttagggttttacgatatttctgnnnnnnnnccggcggtctctccattttccggt |
205 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||||||||||| |
|
|
| T |
39185598 |
actattttcgtttgcatttagtcgcgatcgtttctttagagaaatgttagggttttacgatatttctgtttttt--ccggctgtctctgcattttccggt |
39185501 |
T |
 |
| Q |
206 |
gacgatcttctgttcgtcttccaccgctttgacttcggcggaggcggttctgttccgctataaccgt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39185500 |
gacgatcttctgttcgtcttccaccgctttgacttcggcggaggcggttctgttccgctataaccgt |
39185434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University