View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14507_high_12 (Length: 292)

Name: NF14507_high_12
Description: NF14507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14507_high_12
NF14507_high_12
[»] chr2 (1 HSPs)
chr2 (106-272)||(39185434-39185598)


Alignment Details
Target: chr2 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 106 - 272
Target Start/End: Complemental strand, 39185598 - 39185434
Alignment:
106 actattttcgtttgcatttagtcacgatcgtttctttagagaaatgttagggttttacgatatttctgnnnnnnnnccggcggtctctccattttccggt 205  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||        ||||| |||||| |||||||||||    
39185598 actattttcgtttgcatttagtcgcgatcgtttctttagagaaatgttagggttttacgatatttctgtttttt--ccggctgtctctgcattttccggt 39185501  T
206 gacgatcttctgttcgtcttccaccgctttgacttcggcggaggcggttctgttccgctataaccgt 272  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39185500 gacgatcttctgttcgtcttccaccgctttgacttcggcggaggcggttctgttccgctataaccgt 39185434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University